IGEM:Stanford/2009/Project Homeostasis/sequences/Il6HlyAs

From OpenWetWare

Jump to: navigation, search

 

Home Team Project Parts Notebook Archives



hIL-6 hlyAs

  • Sequence: length= 887

gaattcgcggccgcttctagATGCCAACAATAACCACTGCACAAATTAAAAGCACACTACAGTCTGCAAAGCAATCCT CTGCAAATAAATTGCACTCAGCAGGACAAAGCACGAAAGATGCATCACCGGTTCCGCCGGGTGAAGACTCTAA AGATGTTGCGGCGCCGCACCGTCAGCCGCTGACCTCTTCTGAACGCATTGACAAACAAATTCGTTACATCCTGG ACGGCATCTCTGCCCTGCGTAAGGAGACCTGTAACAAAAGCAACATGTGTGAAAGCAGCAAAGAAGCGCTGGC AGAAAACAACCTGAACCTTCCGAAAATGGCTGAAAAAGATGGTTGCTTCCAATCTGGCTTCAATGAAGAAACTT GCCTGGTGAAAATCATCACCGGTCTTTTGGAGTTTGAAGTATACCTGGAATATCTGCAAAACCGTTTTGAAAGCA GCGAGGAACAAGCGCGTGCTGTGCAGATGAGCACCAAAGTTCTGATCCAGTTCCTGCAAAAAAAGGCGAAAAAT CTGGATGCAATCACTACCCCGGACCCGACCACCAACGCTAGCCTGCTGACGAAACTGCAAGCGCAGAACCAGTG GCTGCAAGACATGACCACTCATCTGATTCTGCGCAGCTTTAAAGAATTTCTGCAATCTAGCCTGCGCGCTCTTCG TCAAATGAATGCATTAGCCTATGGAAGTCAGGATAATCTTAATCCATTAATTAATGAAATCAGCAAAATCATTTCA GCGGCAGGTAATTTTGATGTTAAAGAGGAAAGAGCGGCAGCTTCTTTATTGCAGTTGTCCGGTAATGCCAGTGAT TTTTCATATGGACGGAACTCAATAACTTTGACAGCATCAGCATAActgcagcggccgctactagta


  • Forward Primer: gtttcttcGAATTCGCGGCCGCTTCTAGATGCCAACAATAACCACTGCAC
    • Length= 50 GC= 50% Melt= 69.4C


  • Reverse Primer: gtttcttcctgcagcggccgctactagtaTTATGCTGATGCTGTCAAAG
    • Length= 49 GC= 49% Melt 68.2C



Project
Research Proposal
Systems Overview
Cloning Plan
Sequences & Primers
Anti-Inflammation
Device Overview
Parts Design
Challenges
Results
Anti-Immunosuppression
Device Overview
Parts Design
Challenges
Results
Protocols
Modeling
Overview
Notebook
Results
Future Work
Archived Work
Personal tools