IGEM:UNAM-Genomics Mexico/2009/Notebook/Collaborations/2010/09/10

From OpenWetWare

Jump to: navigation, search
WiFi Coli Collaborations Main project page
Previous entry      Next entry

Interchanging Parts Information

Hi Maria and Edinburgh team!

It was very nice to receive news from you. We really hope that despite the actual situation with your reduced team, everything works out with your project. In our experience, we now know that working in an iGEM project is a huge challenge, there is always a lot of work to do but we are always trying to do our best and we are sure that all of you are also doing the same.

Well, about our parts you can find more detailed information at the following link:

http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=UNAM-Genomics_Mexico

The three next parts were synthesized and they don´t have any promoter. At the ends they have the prefix and suffix sequences. Their sequences are those reported in the registry page aforementioned, but I am sending the Mr. Gene sequences for any possible delay in our annotation.

1. PCR amplified product containing green light photosensor CcaS and CcaR response regulator.


>projectID|14435| csar_csas_noscar_rbs_pANY (n/a / n/a) GAATTCGCGGCCGCTTCTAGAGTCACACAGGAAAGAACAGCTATGGGCAAATTTCTAATTCCAATCGAATTTGTTTTTCT GGCGATCGCCATGACCTGTTATTTATGGCACAGACAAAACCAAGAACGCCGCAGGATTGAAATTAGCATCAAGCAACAAA CCCAACGGGAACGATTTATTAACCAAATTACCCAACATATCCGCCAATCTTTAAACTTGGAAACGGTTTTAAATACCACC GTCGCTGAAGTTAAAACCCTGTTGCAAGTTGATCGAGTTCTAATTTATCGCATTTGGCAAGATGGCACGGGCAGCGCCAT TACGGAATCGGTGAATGCCAATTATCCTAGTATTTTAGGGCGGACCTTTTCCGATGAAGTTTTTCCCGTTGAATACCATC AAGCCTACACCAAAGGTAAAGTACGGGCCATTAATGACATTGACCAGGATGACATAGAGATTTGCCTAGCTGATTTCGTC AAACAATTTGGCGTGAAATCAAAATTAGTAGTGCCCATTCTTCAACATAATCGTGCTTCTTCCCTAGATAATGAATCAGA ATTTCCCTATCTTTGGGGGCTGTTAATTACCCATCAATGTGCTTTTACCCGGCCATGGCAACCGTGGGAAGTGGAGTTAA TGAAACAGCTAGCCAATCAGGTCGCGATCGCCATCCAACAATCGGAATTATATGAGCAATTACAGCAACTCAATAAAGAT TTGGAAAACCGAGTCGAAAAACGCACCCAGCAACTTGCCGCCACCAATCAATCCCTAAGAATGGAAATCAGTGAGCGACA AAAAACGGAAGCCGCTCTCCGCCACACTAACCATACTCTGCAATCCCTGATTGCGGCCTCCCCCAGGGGTATTTTTACCC TTAATTTAGCAGACCAAATTCAGATTTGGAATCCTACAGCAGAACGTATTTTTGGTTGGACAGAAACAGAAATTATTGCC CATCCAGAATTATTAACATCCAACATTTTGCTGGAAGATTATCAGCAATTTAAACAGAAAGTTTTATCAGGCATGGTTTC CCCTAGCCTAGAATTAAAATGTCAAAAAAAAGATGGTAGTTGGATTGAAATTGTCCTTTCCGCTGCTCCCCTATTGGATA GTGAAGAAAATATTGCCGGATTGGTGGCGGTTGTCGCCGATATTACCGAGCAAAAGCGGCAGGCAGAACAAATTCGTTTG CTACAATCCGTTGTGGTTAATACTAATGATGCGGTGGTGATTACGGAAGCGGAGCCCATTGATGATCCCGGGCCGAGAAT ACTCTATGTCAATGAAGCATTTACTAAAATCACCGGTTATACTGCTGAAGAAATGCTAGGCAAAACCCCCCGAGTTTTAC AGGGACCAAAAACCAGTCGCACTGAATTAGATAGGGTGCGGCAAGCCATTAGTCAATGGCAATCAGTTACCGTTGAAGTG ATTAATTATCGTAAGGATGGCAGTGAGTTTTGGGTGGAATTTAGTCTGGTGCCCGTTGCCAATAAAACAGGTTTTTACAC CCATTGGATTGCTGTGCAAAGGGATGTCACTGAGCGCCGACGCACGGAGGAAGTCCGCCTAGCTTTAGAACGGGAAAAAG AATTAAGCCGCCTAAAAACTCGTTTTTTCTCCATGGCTTCCCATGAATTTCGTACTCCCCTCAGTACGGCCTTAGCTGCT GCCCAATTACTGGAAAATTCTGAAGTGGCCTGGCTTGATCCCGATAAGCGTAGCCGGAACTTACACCGTATTCAAAATTC CGTGAAAAATATGGTACAGCTCCTGGATGATATTTTAATCATTAACCGTGCCGAAGCGGGCAAATTGGAATTTAATCCTA ATTGGTTAGATTTGAAATTATTGTTCCAGCAATTTATCGAAGAAATTCAATTAAGTGTCAGTGACCAATATTATTTTGAC TTTATTTGTAGCGCTCAAGATACGAAGGCATTGGTGGATGAAAGGTTAGTGCGGTCTATTTTATCTAATCTGTTATCTAA TGCGATTAAATACTCTCCCGGGGGAGGGCAGATTAAAATTGCCCTAAGCCTAGATTCGGAACAGATTATTTTTGAAGTCA CCGACCAGGGCATTGGCATTTCGCCAGAGGACCAAAAGCAAATTTTTGAACCCTTTCATCGGGGCAAAAATGTCAGAAAT ATTACGGGAACAGGACTCGGTTTAATGGTTGCCAAGAAATGTGTTGACTTACACAGTGGCAGTATCTTGCTAAAAAGTGC AGTTGACCAGGGAACAACAGTTACTATCTGTTTAAAACGCTATAACCATTTGCCTCGAGCTTAGTAATAATACTAGAGAC TTTAAGCACAGGAAAGATATCATATGAGAATACTTTTAGTGGAGGATGATTTGCCGCTGGCGGAAACCCTTGCTGAAGCA TTGAGTGACCAGCTTTACACCGTTGATATTGCCACCGACGCTTCCCTCGCCTGGGACTATGCCTCCCGACTGGAATATGA CCTCGTTATTTTGGATGTGATGCTGCCGGAGTTGGACGGGATTACCCTCTGTCAAAAATGGCGATCGCACAGTTATTTAA TGCCAATTTTGATGATGACAGCCAGGGATACGATCAATGATAAAATCACGGGCTTGGATGCGGGGGCGGATGATTATGTG GTCAAGCCAGTGGATTTGGGGGAGTTATTTGCCAGGGTGCGAGCTTTGTTGCGTCGGGGTTGTGCAACGTGCCAACCAGT TTTAGAGTGGGGGCCAATCAGGTTGGACCCAAGCACCTATGAAGTTAGTTATGACAATGAGGTTTTGTCTTTGACCCGCA AGGAATACAGCATTCTGGAATTACTACTCCGCAATGGCCGTCGGGTGCTAAGTCGGAGCATGATTATCGATAGTATCTGG AAGTTGGAGAGTCCCCCAGAGGAAGATACGGTTAAGGTGCATGTGCGGAGTTTGCGACAAAAATTAAAAAGTGCCGGTTT ATCAGCAGATGCCATTGAAACGGTCCATGGCATTGGGTATCGTCTGGCCAATTTAACGGAAAAATCTTTGTGCCAAGGGA AAAACTAGTAATAACCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGT CGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCT GCAG


IMPORTANT: This sequence was modified because it had a SpeI restriction site, thus the PCR product that we sent you is shorter. The sequence corrected is the one reported at the registry page and includes the prefix and suffix sequences in the ends.

We did't have time to purify this PCR reaction, so that it has a label as not cleaned PCR product, but the other PCR reactions were correctly purified.


2. PCR amplified product containing blue light photosensor LovTAP. Full length 889 nt, including the prefix and suffix sequences.

>projectID|14201| 2_LovTap_pANY (n/a / n/a) GCGAATTCGCGGCCGCTTCTAGAGTCACACAGGAAAGTACTATGTTGGCTACTACACTTGAACGTATTGAGAAGAACTTT GTCATTACTGACCCAAGGTTGCCAGATAATCCCTTTATATTCGCGTCCGATAGTTTCTTGCAGTTGACAGAATATAGCCG TGAAGAAATTTTGGGAAGAAATTGTCGTTTTCTACAAGGTCCTGAAACTGATCGCGCGACAGTGAGAAAAATTAGAGATG CCATAGATAACCAAACAGAGGTCACTGTTCAGCTGATTAATTATACAAAGAGTGGTAAAAAGTTCTGGAACCTCTTTCAC TTGCAGCCTATGCGAGATCAGAAGGGAGATGTCCAGTACTTTATTGGGGTTCAGTTGGATGGAACTGAGCATGTCCGAGA TGCTGCCGAGAGAGAGGGAGTCATGCTGATTAAGAAAACCGCCGAAAATATTGATGAGGCGGCATTTGTCGACCTGCTTA AGAATGCCTACCAAAACGATCTCCATTTACCGTTGTTAAACCTGATGCTGACGCCAGATGAGCGCGAAGCGTTGGGGACT CGCGTGCGTATTGTCGAAGAGCTGTTGCGCGGCGAAATGAGCCAGCGTGAGTTAAAAAATGAACTCGGCGCGGGCATCGC GACGATTACGCGTGGATCTAACAGCCTGAAAGCCGCGCCCGTGGAGCTGCGCCAGTGGCTGGAAGAGGTGTTGCTGAAAA GCGATTAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTG TTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGG CCGCTGCAG


3. PCR amplified product containing a YFP protein, LuxY. Full length 820 nt, including the prefix and suffix sequences.


>projectID|14198| 2_LuxY_pANY (n/a / n/a) GCGAATTCGCGGCCGCTTCTAGAGTTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCAAAGAGGAAACAGCTATGTTT AAAGGTATAGTAGAAGGTATAGGAATCATTGAAAAAATTGATATATATACTGACCTAGATAAGTATGCAATTCGATTTCC TGAAAATATGTTGAATGGAATTAAAAAGGAGTCGTCAATAATGTTTAACGGATGCTTCTTAACGGTAACTAGCGTAAATT CAAACATTGTCTGGTTTGATATATTTGAAAAAGAAGCACGTAAGCTTGATACTTTTCGGGAATATAAGGTAGGTGACCGA GTAAATTTAGGAACATTCCCAAAATTTGGCGCTGCATCTGGTGGGCATATATTATCAGCAAGGATTTCATGTGTAGCAAG TATTATTGAAATAATAGAAAATGAGGATTATCAACAAATGTGGATTCAAATTCCTGAAAATTTTACAGAGTTTCTTATTG ATAAAGACTATATTGCTGTGGATGGTATTAGCTTAACTATTGACACTATAAAAAACAACCAATTTTTCATTAGTTTACCC TTAAAAATAGCACAAAATACAAATATGAAATGGCGAAAAAAAGGTGATAAGGTAAATGTTGAGTTATCAAACAAAATTAA TGCTAACCAGTGTTGGTAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGT TTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATAT ACTAGTAGCGGCCGCTGCAG

The LuxAB genes were obtained from Vibrio Fischeri Genomic DNA, the product include the prefix and suffix sequences.

Its sequence is at the registry page, but if further information is needed please contact to Augusto and Daniela.


The information about the LovTAP ligations with promoters (J23117, J23105, J23114 and J23102) inside plasmid J61002 can be found at the next link:

http://openwetware.org/wiki/IGEM:UNAM/2009/Notebook/Modeling_logbook_Claudia/2010/08/26

The information of the blue light promoter will be updated today at the registry page.

If there are any questions, please contact us.

According to the information that you sent us, we are very interested in receive the following parts:

-LovTap readout system. -PCB production plasmid. -luxCDE genes.

We would like to have more information about the red Firefly luciferase mutation - Is it functional? if so, we would also wanted to receive it, despite that it wasn´t as a registry-standard part.

About the other parts that you mentioned- red light sensor and the fuse luxAB with lumP- they would be also very useful but if your team is still working on them maybe they could be sent later.

Thank you so much for stay in touch with us.

Regards and Good Luck!

UNAM-Genomics-Mexico Team



Personal tools