IGEM:UNAM/2009/Notebook/Modeling logbook Claudia/2010/04/12

UNAM-Genomics-Mexico team

Main project page Previous entry      Next entry

Objective: Part LovTap design We decided to synthesize a new LovTap part, that in comparison with the Part:BBa_K191003 [1] that is already at the registry, has the following differences: 1. The 2 PstI restriction sites were removed from the coding region of LovTap. 2. We included a punctual mutation to change the ILE427 by a PHE427, as was proposed by the model results of the team iGEM09_EPF-Lausanne [2]. With this mutation LovTAP should react faster and the conformational change should be more stable (the protein stays in the active form for longer, under light induction). The reason of the conformational change is the following: Cys450 side chain is involved in light state in bond formation with the cofactor. Cys450 can assume two conformational states, called here ON and OFF, and corresponding respectively, to the Sg being near or far from FMN[2]. The isoleucine 427 is quite big. But not enough to push the cystein's side chain significantly toward the cofactor. So we choose to replace this ILE427 by an PHE427, an amino acid which is much bigger and have more or less the same propreties than the ILE[2]. 3. The part does not include a promoter. We eliminated the inverting regulator sensitive to LacI and CAP protein(Part:BBa_R0010) [6]. According to the report of EPF-Laussane team [3], the expression levels of LovTAP under the inverting regulator, doesn´t seem to show differences to the induction with IPTG. Thus, we decided to remove it and as we know that the level expression of LovTAP must be low, we plan to test weak promoters to choose the best option and include it in the construction. 4. The RBS was changed from a strong (Part: BBa_B0030) [4] to a medium strength (Part:BBa_B0032) [5], thus expecting a low expression of lovTAP. 5. The stop codon tga was changed for two taa. So, the final DNA sequence design is : Prefix: gcgaattcgcggccgcttctagag Promoter: None RBS: BBa_B0032 tcacacaggaaagtact CDS: atgttggctactacacttgaacgtattgagaagaactttgtcattactgacccaaggttgccagataatcccttta tattcgcgtccgatagtttcttgcagttgacagaatatagccgtgaagaaattttgggaagaaattgtcgttttctacaaggtcctgaaactgatcgcgc gacagtgagaaaaattagagatgccatagataaccaaacagaggtcactgttcagctgattaattatacaaagagtggtaaaaagttctggaacctcttt cacttgcagcctatgcgagatcagaagggagatgtccagtactttattggggttcagttggatggaactgagcatgtccgagatgctgccgagagagagg gagtcatgctgattaagaaaaccgccgaaaatattgatgaggcggcatttgtcgacctgcttaagaatg cctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagagctgtt gcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcgggcatcgcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtggag ctgcgccagtggctggaagaggtgttgctgaaaagcgattaataa Double transcriptional terminator: tactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagag tcacactggctcaccttcgggtgggcctttctgcgtttata Suffix: tactagtagcggccgctgcag References 1. Registry entry: Part:BBa_K191003 2. Wiki Team: EPF-Laussane. Simulations and results of predicted lovTAP mutations. 3. Wiki Team: EPF-Laussane. LovTAP characterization results. 4. Registry entry: Part:BBa_B0030 5. Registry entry: Part:BBa_B0032 6. Registry entry: Part:BBa_R0010