IGEM:UNAM/2009/Notebook/Modeling logbook Claudia/2010/10/04

From OpenWetWare

Jump to: navigation, search
UNAM-Genomics-Mexico team Main project page
Previous entry      Next entry

Repeated experiment: Working on LovTAP.Reporter systems: PCR to fuse trpL promoter

Due to the previous PCR reactionsamplified two bands around the expected size. I'm going to test new temperature conditions and template dilutions, as well I will make some reactions using Dimethyl Sulfoxide.

Experimental Setup

1.Insert the trpL promoter through a PCR reaction to the plasmid pSB1C3.

-trpL promoter sequence

tggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcAagttcacgtaaaaagggtat

New Primer designed

-Primer_trpL_reverse (5'->3'): NheI site + trpL promoter + XbaI site + EcoRI site TTGCTAGCGTGAACTTGCGTACTAGTTAACTAGTTCGATGATTAATTGTCAACAGCCTCTAGAAGCGGCCGCGAATTC

-Primer forward (5'->3'): Suffix

-Template: Plasmid pSB1C3

  • PCR taq platinum reaction mixture
Reactive Quantity
Buffer 10X PCR Buffer minus M 5μL
10mM dNTP mixture 1μL
50mM MgCl2 1.5μL
Primer mix (10μΜ each) 1μL each
Template DNA (plasmid pSB1C3)Dilutions (1:20, 1:100 and 2:100) 1μL
Platinum Taq DNA polymerase 0.2μL
HPLC Up to a final volume of 50 μL of the mixture (39.3 μL)
  • 35 PCR programmed cycles:

The reaction starts at 95°C during 5 min.

Each cycle is programmed as follows:

Temperature Time
94°C 45s
58°C, 60°C and 63°C 45s
72°C 2:30 min

After the cycle 35, the temperature changes to 72°C during 5 min and ends at 4°C.

Results:PCR with promoter trpL

Taq platinum PCR trpL+pSB1C3. Lane1:Ladder. Lanes 2,3 and 4: PCR amplified product trpL+pSB1C3. Template Dilutions 1:20 ,1:100 and 2:100 respectively. Tm at 58°C. Lanes 5,6 and 7: PCR amplified product trpL+pSB1C3. Template Dilutions 1:20 ,1:100 and 2:100 respectively. Tm at 60°C. Lanes 8,9 and 10: PCR amplified product trpL+pSB1C3. Template Dilutions 1:20 ,1:100 and 2:100 respectively. Tm at 63°C.Lanes 11,12 and 13: PCR amplified product trpL+pSB1C3. Template Dilutions 1:20 ,1:100 and 2:100 respectively. PCR mixture plus 5 μL of Dimethyl sulfoxide Tm at 58°C. Lanes 14 and 15: PCR amplified product trpL+pSB1C3. Controls.PCR mixture plus  and without 5 μL of Dimethyl sulfoxide, respectively. Tm at 58°C. Template:previous PCR reaction.
Taq platinum PCR trpL+pSB1C3. Lane1:Ladder. Lanes 2,3 and 4: PCR amplified product trpL+pSB1C3. Template Dilutions 1:20 ,1:100 and 2:100 respectively. Tm at 58°C. Lanes 5,6 and 7: PCR amplified product trpL+pSB1C3. Template Dilutions 1:20 ,1:100 and 2:100 respectively. Tm at 60°C. Lanes 8,9 and 10: PCR amplified product trpL+pSB1C3. Template Dilutions 1:20 ,1:100 and 2:100 respectively. Tm at 63°C.Lanes 11,12 and 13: PCR amplified product trpL+pSB1C3. Template Dilutions 1:20 ,1:100 and 2:100 respectively. PCR mixture plus 5 μL of Dimethyl sulfoxide Tm at 58°C. Lanes 14 and 15: PCR amplified product trpL+pSB1C3. Controls.PCR mixture plus and without 5 μL of Dimethyl sulfoxide, respectively. Tm at 58°C. Template:previous PCR reaction.



Personal tools