IGEM:UW/2008/Notebook/iGEM UW Team/2008/05/22

From OpenWetWare

Jump to: navigation, search
University of Warsaw iGEM Team 2008 Main project page
Previous entry      Next entry

1. Design of primers for sequencing something we want from pMPM-T5

Primers:

pMPMT5seqF CTACTGTTTCTCCATACCCG

pMPMT5seqR GAAAATCTTCTCTCATCCGC

AIDseqP GCTTCGGCGCATCCTTTTG


Personal tools