IGEM:UW/2008/Notebook/iGEM UW Team/2008/06/05

From OpenWetWare

Jump to: navigation, search
University of Warsaw iGEM Team 2008 Main project page
Previous entry      Next entry


1. Transformants E.coli TOP10 with pZC320 (liquid LB)

2. Design of primers for sequencing β-galactosidase from pZC320

Primers:

pZCseqL  CTTGACCCGCAGTTGCAAAC
pZCseqP  CCCAACTGATCTTCAGCATC


Personal tools