JCA062306-Construction of pJ23004

From OpenWetWare

Jump to: navigation, search

PCR ca1002F/R on pSB1A3-I13521 (987 bp, EcoRI/PstI, Neb2)
Sub into pSB1A3-I13521 (EcoRI/PstI, Neb2)
Product is pJ23004


ca1002F Forward EcoRI oligo to make XbaI blunter cassette
cttctggaattcgcggccgcaactagtgtccctatcag
ca1002R Reverse PstI oligo to make SpeI blunter cassette
gaagcctgcagcggccgctTctagAatataaacgcag

Personal tools