Jacobs:Genotyping Tailsnips

From OpenWetWare

Jump to: navigation, search

Image:CMBL.jpg

Home        Contact        Internal        Lab Members        Publications        Research        Talks        Open Positions        


Contents

Genotyping

Materials

  • Animal box in 367
    • Tweezers
    • Scissors
    • PCR tubes
  • -20 freezer
    • Proteinase K (Roche 20mg/ml)
    • Promega GoTAQ qPCR Master Mix (A60001/2)
    • Custom Primers (see appendix)
  • Cabinet in 372
    • TritonX-100
  • Chemical shelf
    • Tris (Trizma base)
    • Ammonium sulfate (NH4)2SO4
    • Magnesium chloride MgCl2

Procedures

Snipping of mice tails (~1 hr)

  1. Place paper towels under and surrounding area of cage.
  2. Prepare PCR tubes with the mouse number and written on the side.
  3. Wipe down scissors and tweezers using 70% ethanol.
  4. Scruff the mouse, grasping its tail with your pinky.
  5. Using a scissors cut off approximately 1mm from the tip of the tail.
  6. Collect the tip using the tweezers and place in the correctly marked PCR tube.
  7. Repeat for each mouse.

Note: Alternatively, ear clips may be used.

Tissue lysis (~1 hr)

  1. Prepare stock solutions if needed. They can be stored at -20.
    1. 10x Gitschier’s Buffer
      • 3.35ml of 2M Tris pH 8.8 (Final concentration – 670mM Tris pH8.8)
      • 1.66ml of 1M (NH4)2SO4 (Final concentration – 1.66mM Ammonium Sulfate)
      • 1.34ml of 0.5M MgCl2 (Final concentration – 67mM Magnesium Chloride)
      • 3.65ml nanopure H2O
      • 0.05ml of 10% Triton-X 100
    2. Lysis buffer (1ml = 22 samples)
      • 0.85ml H2O
      • 0.10ml 10x Gitschiers Buffer
      • 0.002ml Proteinase K (Roche 20mg/ml)
      • Notes:
        • It’s helpful to prepare a large stock solution and aliquot into 500 uL tubes.
        • You can increase the concentration of Proteinase K to speed up the lysis.
  2. Add 40ul of lysis buffer per sample PCR tube containing tail snip.
  3. Spin down the samples and make sure the tissue is submerged in the buffer.
  4. Lyse in thermocycler
    • 55C – 60 min
    • 55C – 60 min [optional]
    • 95C – 5min
    • Note: Total time at 55C can be reduced to 60 min if short on time.
  5. Store at 4C for short term (1-2 weeks), -20C for long term

qPCR (Duration: <1 hr + 3 hrs wait time)

  1. Prepare complete PCR mix. Volume per 20ul reaction
    • 10ul 2X Promega Master Mix
    • 0.8ul 10uM forward primer
    • 0.8ul 10uM reverse primer
    • 0.2 ul CXR/ROX reference from Promega kit
    • 7.4 ul RNAse free H2O
    • Note: This is assuming 0.8 ul of genomic DNA, but this and the water amount may be adjusted as needed
  2. Add 19.2 ul of PCR mix to each well. Recommend wells in duplicate per primer pair.
  3. Add 0.8ul DNA from tissue lysis (or water for negative control)
  4. Run RT-qPCR
    • Protocol for Ift88 (also ok to use Kif3a protocol)
      • Initial denature 95C 5min
      • Denature 95C 30secs
      • Anneal 60C 45secs
      • Extension 72C 30secs
      • Final extension 72C 5min
      • Cycles 35
    • Protocol for Cre with Myogin control
      • Initial denature 95C 5 min
      • Denature 95C 30secs
      • Anneal 62C 30secs
      • Extension 72C 30secs
      • Final extension 72C 5min
      • Cycles 35

Appendix

  • Ift88 primers
    • BY598 (Common 5’): GCCTCCTGTTTCTTGACAACAGTG
    • BY919 (3’ WT & flox): GGTCCTAACAAGTAAGCCCAGTGT
    • BY956 (3’ null): CTGCACCAGCCATTTCCTCTAAGTCATGTA
  • Kif3a
    • Common 5': AGG GCA GAC GGA AGG GTG G
    • Wildtype: TCT GTG AGT TTG TGA CCA GCC
    • Floxed: TGG CAG GTC AAT GGA CGC AG
  • Cre
    • Forward: GAACC TGATG GACAT GTTCA GG
    • Reverse: AGTGC GTTCG AACGC TAGAG CCTGT
  • Myogin (control used with Cre)
    • Forward: TTACG TCCAT CGTGG ACAGC
    • Reverse: TGGGC TGGGT GTTAG CCTTA
      • Source: "Rapid and effective genotyping of Cre transgenic mice"


Reference

Personal tools