Jessica Karen Wong/Notebook/2007-6-20

From OpenWetWare

Jump to: navigation, search

Added LacZ to the registry

  • Part Number BBa_I2054
  • Got sequence from NCBI
  • Original had an EcoR1 site at bp 3019
  • Performed a point mutation at bp 3021 - changed A to G
    • Both GAA and GAG are codons for gultamic acid

Ordered Primers for I2054

  • I2054_F -- GTT TCT TCG AAT TCG CGG CCG CTT CTA G ATGACCATGATTACGGATTCACTG
  • I2054_R -- GTT TCT TCC TGC AGC GGC CGC TAC TAG TA TTATTATTTTTGACACCAGACCAACTGG
  • Bold is the tail used to build a Biobrick listed in Synthetic Biology:BioBricks/Part fabrication
Personal tools