Jessica Karen Wong/Notebook/2007-6-22

From OpenWetWare

Jump to: navigation, search

Contents

To Do

  • Run gel of T9002 and E0240 PCR
  • PCR Cleanup of T & E
  • Digest T & E with Mfe1 and Nsi1
  • PCR cleanup B, J, and R
  • Ligate and transform B, J, R
  • Log outline, schedule, and parts

Digest Cont'd

  • heat shocked digests for J04650, B0032, R0040, and the plasmids
  • put in 4 degree

Gel

Gel from 6/22/07
Gel from 6/22/07
  • Ran an analytic gel of the PCR product of T9002 and E0240
  • L to R: Ladder, E, T, Ladder, space, Ladder
  • E0240 gave no results and the T9002 fragments are 1kb when the desired product should have been 2kb
  • T9002 has to B0015 sites in it and we conclude it must have cut only at the first site
  • This also explains the absence of E0240 b/c they have the same end sequences
  • Ordered new reverse, E0240F, and T9002F primers

Designing Primers

  • New Reverse Primer (both T9002 and E0240) TCAGCCAT ATGCAT AAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCTCTAGTATTATTATTTG
    • Melting temp without tail is 81.5
    • Is so long because it must go all the way back to some of the GFP

New forward E0240 CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAG

    • Melting temp without tail is 80.9
    • Length is to have similar melting temp as reverse

New forward T9002 CTTAGTAG CAATTG TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTACTAGAGAAAGAGGAGAAATACTAGATG

    • Melting temp 80.0

Bold is the tail, italics is the restriction site.

PCR Purification

Did a PCR cleanup of the 3 backbones, T9002, E0240, B0032, R0040, and J04650

  • Used 50ul of B, R, and J
  • Used 90ul of T & E
  • Protocol is in QIAquick spin handbook

3-way Ligation

Nishant Ligated:

  • R0040, J04650, and 1AT3
  • R, J, and 1AC3
  • B0032, J04650, and 1AT3
  • B, J, 1AC3

Overnights

  • Checked competent cells by transforming with pUC18 and plating on both plain LB and Amp
  • Set up 2 5ml overnight cultures of each plasmid (1AT3, 1AC3, 1AK3, and 3K3)
    • 1 to miniprep and 1 to make glycerol stocks
Personal tools