Jessica Karen Wong/Notebook/2007-6-26

From OpenWetWare

Jump to: navigation, search

Contents

To Do

  • Take out PCR and Digest
  • PCR clean up
  • Run analytic gel on PCR of I
  • Make new Tet plates
  • Re-plate devices
  • Miniprep and digest 3K3
  • Re-order T & E primers?
  • PCR E and I on a gradient


Stopped PCR and heat shocked digest

Poured new Chlor LB plates

Nishant miniprepped and digested 3K3

Gel of overnight PCR

  • Ran an analytic gel on I2055 PCR product see protocol
  • No visible product
  • Will PCR on a temperature gradient

PCR Cleanup

  • PCR purified the 3 sucessful backbone digests (1AC3, 1AK3, 1AT3) and the PCR of I2055
  • Had 50ul of each digest and 90ul of the PCR

Designing Primers

  • New T9002 Reverse that matches only GFP TCAGCCAT ATGCAT CCATGCCATGTGTAATCCCAG
    • Melting Temp 55.0
  • Original T9002_F CTTAGTAG CAATTG TCCCTATCAGTGATAGAGATTGACATC has melting temp 53.9

Bold is the tail, italics is the restriction site.

  • New Longer I2055
    • Fwd- TATAAACGCAGAAAGGCCCACCC
  • Original I2055
    • Fwd- CTTAGTAG + CAATTG + tccctatcagtgatagagattgacatc
    • Rev- TCAGCGAT + ATGCAT + TATAAACGCAGAAAGGCCCAC

Gradient PCR

  • Did a 10ul analytic PCR of E0240 and I2055 on a gradient from 49 to 60
    • E0240F melting temp - 53.1
    • E0240R - 53.6
    • I2055F - 53.9
    • I2055R - 53.6
  • Temperature in each of the 12 columns: 1st - 49, 2nd- 49.3, 3rd- 49.9, 4th-50.8, 5th-52.1, 6th- 53.7, 7th- 55.6, 8th- 57.2, 9th- 58.3, 10th- 59.2, 11th- 59.8, 12th- 60

Plated Devices

  • From yesterday's overnight plates only saw colonies on blue C (RBS tester on Chlor)
  • Spun down the rest of the cultures at 4k for 4 min
  • Removed most of supernatant and resuspended in the remaining 100ul of LB
  • Plated both devices on both Tet and Chlor

Gel of Gradient PCR

Gel from 6/26/07
Gel from 6/26/07
  • Ran a 2 row 20-lane analytic gel
  • 1. E0240 _ L _ _ 1 2 3 ...12 _ L _ _
  • 2. I2055 _ _ L _ 1 2 3 ...12 _ _ L _
  • E0240 has a bright band of reasonable length (slightly <1k)
  • I2055 is very blurry and the brightest band is 3x longer than the part - very strange
Personal tools