Jessica Karen Wong/Notebook/2007-7-12

From OpenWetWare

Jump to: navigation, search


  • Minipreped overnight cultures of E0240-3K3, I2057-3K3, T9002-3K3, T9002-1AK3 for sequencing
  • Sequencing I2057-3K3 w/ VF and VR
    • E0240-3K3 with E0040F and E0040R
    • T9002-3K3 with E0040F and R
    • T9002-1AK3 with F2620F and R (aka c62VF and c62VR)
  • Made overnights of E0240-1AK3 and T9002-3K3 (to look for F2620) to sequence tomorrow


  • Ran gel of overnight I2055 col PCR and E0240 BB pcr
  • Nothing was right
  • Redid E0240 BB PCR with Vent and a 3x dilution of DNA

Ordered New Primers


  • F2620-R 8mer xba1 not1 eco1 TTTATTCGACTATAACAAACCATTTTC 51.9

  • E0240-F 8mer spe1 NOT1 pst1 TCACACAGGAAAGTACTAGATGCG 53.1
  • E0240-R 8mer nsi1 GTGGGCCTTTCTGCGTTTATA 53.6


  • I2055-R 8mer xba1 NOT1 ecor1 GTGCTCAGTATCTCTATCACTGATAGG 52.0
  • I2056-F 8mer Xba1 ATGGCTTCCTCCGAAGACG 54.0
  • I2056-R same as I2055-R
Personal tools