Jessica Karen Wong/Notebook/2007-7-18

From OpenWetWare

Jump to: navigation, search

Biobrick Primers

  • E0240:
    • F_New (incl E0240, Spe1): CTTAGTAG.ACTAGT.TCACACAGGAAAGTACTAGATGCG (53.1)
    • R Same as before (incl 3K3/1AK3, EcoRI): TCAGCGAT.GAATTC.CAGAAATCATCCTTAGCGAAAGC (54.2)


  • I2057:
    • F (incl I2057, Spe1): CTTAGTAG.ACTAGT.TCACACAGGAAAGTACTAGATGGC (52.1)
    • R: same as E0240

T9002 E0240 piece

  • E0240-F 8mer spe1 TCACACAGGAAAGTACTAGATGCG 53.1
  • Same as E0240_BB_F


PCR/Gel

  • Ran a gel of E0240-3K3 BB PCR and E0240_T9002 tails PCR - nothing showed up
  • Made a Colony PCR of the 1 colony of F2620-3K3
    • Ran a gel of it and looks good - minipreped for sequencing
  • PCR'ed another 100ul E0240_T9002 tails PCR at 51 with vent and a 1:30 ext time


Sequencing

  • Got some of the redone sequencing from monday
  • E0240-3K3 looks scarred on both sides
  • I2055-3K3 is scared but has a random 1 base insertion towards the end
  • I2055-1AK3 still has no promoter
  • Minipreped I2055-3K3 (that we're pretty sure contains the promoter) for seq
  • Shouldn't put too much faith in these b/c these results still aren't the ones we made glycerols of
Personal tools