Jessica Karen Wong/Notebook/2007-7-4
From OpenWetWare
Jump to navigationJump to search
- Took out overnight plates of I2056 transformation and saw no more colonies
- PCR of I2055 also evaporated, redoing with 20ul and different tube
- Got I2057 sequence which matches registry
- Preped colonies 3, 4, and 6 of I2055 for sequencing
- Minipreped and eluted with 30 ul pH 8.5 water instead of EB
- used the 8-tubes, 2 samples of each colony, VR and VF
- Mix: 2ul primer, x ul DNA to make b/t 200 and 500 ng, (10-x)ul water
- Submitted order on dnalims.mit.edu
- Building was locked so it's in the 4 degree
- Digested T9002 with Mfe1
- used buffer 4 and 11 ul T9002
- Need scarring primers for I2056, I2057
- I2056:
- F: Same as I2055
- R: same as I2055
- I2056:
- I2057:
- F: CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGGC (52.1)
- R: same as I2055
- I2057: