Knight:Evolving Reshmaverters/Promoter library design

From OpenWetWare

Jump to: navigation, search

Contents

Promoter library design

In progress!

Promoter architecture

                 -35                    -10        +1
                ______                 ______       _
----------------TTGACA-----------------TATAAT----- CA------------------- (consensus)
----------------TTGCTT-----------------TATAAT-GATT CATAAATTTGAGAGAGGAGTT (good promoter clearance?) [1]
----------------TTGACT-----------------GATACT------CA------------------- (repressible, low KON?)[2]

----------------TTGACCccacgcgtggg------TATAAT----- CA------------------- (operator site in position of maximum steric interference with RNAP)[3, 4, 5]
----------------TTGACA---------CccacgcgTGGGAT----- CA------------------- (operator site in position of maximum steric interference with RNAP)[3, 4, 5]

Constant promoter

                 -35                    -10        +1
                ______                 ______       _
tttatcaaaaagagtgTTGATCccacgcgtgggatatagGATACTtagattcataaatttgagagaggagtt (promoter9)
tttatcaaaaagagtgTTGACAtttttaagtcccacgcgTGGGATtagattcataaatttgagagaggagtt (promoter8)

Questions

  1. Do I include too much extraneous sequence? These promoters are longer to reflect those found in papers.

Libraries

                 -35                    -10        +1
                ______                 ______       _
tttatcaaaaagagtgTTGNTCccacgcgtgggannnnnNATANTnnnnnncannnnnnnnnn (based on promoter9)
tttatcaaaaagagtgTTGACAnnnnnnnntcccacgcgTGGGATnnnnnncannnnnnnnnn (based on promoter8)
       nnnnnnnnnTTGNCAnnntcccacgcgcgtggGATANTnnnnnnca (based on BBa_R2000)

Questions

  1. Are these promoters likely to be functional? Too much sequence diversity?
  2. I potentially don't need to vary the -35 and -10 from consensus because I can still achieve a range of promoter strengths without changing them. [6]

Operator

 0 site operator: cccacgcgcgtggg (14bp)
-2 site operator: cccacgc  gtggg (12bp) (higher affinity)

Brainstorming

How could these regulatory regions be redesigned to be repressible?

Comments welcome

  • Repressor sites tend to fall between the -35 and -10 regions and/or downstream of the -10 (around the +1). (Not upstream of the -35). [7, 8]
  • Binding of the repressor dimer to the promoter may lead to DNA bending rendering binding of more dimers unfavorable. Perhaps a single binding site is preferable?
  • The TG sequence at -16 is causing the regulatory regions to be too strong in the derepressed state. The RNA polymerase is "winning" the competition for binding with the repressor. Perhaps this dinucleotide should be removed. [9, 10]
  • A high kON (rate of complex formation between RNA polymerase and promoter) correlates inversely with repressibility. High kON may result in RNAP outcompeting the repressor for the regulatory region binding. High regulatory region clearance rates enable strong transcription initiation and allow for repressor binding.[2]
  • +1 base should be an A with 6-7 bases between end of -10 hexamer and +1. [1, 2]
  • Use the -2 operator site because it binds the homodimer more tightly. (But it is less modular).
  • How can we design promoters with low kON but high clearance rates for improved repressibility?
    • KON and promoter occupancy by RNAP is determined by the -35 and -10 hexamers. Closer to consensus sequences means high kON and more stable RNAP-promoter complexes. [11]
    • An AT rich region around the transcription start site may lead to better promoter clearance? [1, 11]

Existing promoters

The following promoters have been tested and are not repressible under my testing conditions. 

Heterodimers:
                         -35                    -10
Promoter1 cacgtgtgcgtgggTTGACAcgtgtgcgtgggaagtcGATACTgagcaca
Promoter2*              TTGACAcgtgtgcgtgggaagtcGATACTtagattcacgtgtgcgtggg
Promoter3 cacgtgtgcgtgggTTGACAcgtgtgcgtgggaagtcGATACTtagattcacgtgtgcgtggg
Promoter4 cacgtgtgcgtgggTTGACAcacgtgtgcgtgggaatGATACTgagcaca
Promoter5               TTGACAcacgtgtgcgtgggaatGATACTtagattcacgtgtgcgtggg
Promoter6 cacgtgtgcgtgggTTGACAcacgtgtgcgtgggaatGATACTtagattcacgtgtgcgtggg

Homodimers:
                    -35                   -10
BBa_R2000 agtttattcTTGACAtggtcccacgcgcgtggGATACTacgtcag
BBa_R2001 agtttattcTTGACAtggtcatattacggtgaGATACTcccacgcgcgtggg
BBa_R2002 agtttattcTTGACAtggtcccacgcgcgtggGATACTcccacgcgcgtggg

These promoters are too weak under my testing conditions. (Some were not clonable). 

Homodimers:
                            -35                    -10        +1
                           ______                 ______       _
BBa_R2108  tttatcaaaaagagtgTTGACAtttttaagtcccacgcgTGGGATtagattcataaatttgagagaggagtt
BBa_R2110  tttatcaaaaagagtgTTGACAtttttaagctcccacgcGTGGGTtagattcataaatttgagagaggagtt
BBa_R2112  tttatcaaaaagagtgTTGACAtttttaatcccacgcgtGGGAATtagattcataaatttgagagaggagtt
BBa_R2109  tttatcaaaaagagtgTTGATCccacgcgtgggatatagGATACTtagattcataaatttgagagaggagtt
BBa_R2111  tttatcaaaaagagtgTTGACTcccacgcgtgggaatagGATACTtagattcataaatttgagagaggagtt
BBa_R2113  tttatcaaaaagagtgTTGTCCcacgcgtgggactatagGATACTtagattcataaatttgagagaggagtt
BBa_R2114  tttatcaaaaagagtgTTGACTcccacgcgtgggaatagGATATTtagattcataaatttgagagaggagtt

References

Promoter design

  1. Kammerer W, Deuschle U, Gentz R, and Bujard H. . pmid:3539590. PubMed HubMed [Kammerer-EMBO-1986]
  2. Lanzer M and Bujard H. . pmid:3057497. PubMed HubMed [Lanzer-PNAS-1988]
  3. Collado-Vides J, Magasanik B, and Gralla JD. . pmid:1943993. PubMed HubMed [Collado-Vides-MicrobioRev-1991]
  4. Gralla JD. . pmid:1868543. PubMed HubMed [Gralla-Cell-1991]
  5. Burr T, Mitchell J, Kolb A, Minchin S, and Busby S. . pmid:10756184. PubMed HubMed [Burr-NAR-2000]
  6. Voskuil MI, Voepel K, and Chambliss GH. . pmid:7494476. PubMed HubMed [Voskuil-MolMicrobiol-1995]
  7. Ellinger T, Behnke D, Bujard H, and Gralla JD. . pmid:8006961. PubMed HubMed [Ellinger-JMB-1994]
  8. Lutz R and Bujard H. . pmid:9092630. PubMed HubMed [Lutz-NAR-1997]
  9. Besse M, von Wilcken-Bergmann B, and Müller-Hill B. . pmid:3015603. PubMed HubMed [Besse-EMBO-1986]
All Medline abstracts: PubMed HubMed

Structures

  1. Wolfe SA, Ramm EI, and Pabo CO. . pmid:10903945. PubMed HubMed [Wolfe-Structure-2000]
  2. Murakami KS, Masuda S, and Darst SA. . pmid:12016306. PubMed HubMed [Murakami-Science-2002a]
  3. Murakami KS, Masuda S, Campbell EA, Muzzin O, and Darst SA. . pmid:12016307. PubMed HubMed [Murakami-Science-2002b]
All Medline abstracts: PubMed HubMed

Promoter libraries

  1. Hammer K, Mijakovic I, and Jensen PR. . pmid:16406119. PubMed HubMed [Hammer-TrendsBiotechnol-2006]
  2. Alper H, Miyaoku K, and Stephanopoulos G. . pmid:16502313. PubMed HubMed [Alper-PNAS-2005]
  3. Fischer CR, Alper H, Nevoigt E, Jensen KL, and Stephanopoulos G. . pmid:16380177. PubMed HubMed [Fischer-TrendsBiotechmol-2006]
All Medline abstracts: PubMed HubMed
Retrieved from "http://www.openwetware.org/wiki/Knight:Evolving_Reshmaverters/Promoter_library_design"
Personal tools