LabName:Supplementary

From OpenWetWare

Jump to: navigation, search

Home        Team        Project        Experiment        Supplementary        Sponsors       


Contents

Details of Spider Silk

Cadnano designs


Sequence

scaffold

  • Scaffold of 4539NT

GATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATT GGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGT GATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCTTGAG GAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCACT GACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCT GGCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCT GGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTT GATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTC GCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCC CAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTT GTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTT ATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGTT TCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTG GGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGC TTCCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATG GCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACT AATCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATATCTGATTTG CTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAAT GATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAA CAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGC TCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAAT TTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTC AAACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTT ACATATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTT AATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTA TGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGT AATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGT TACTGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTC CATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAATATGATGATAATTCCGCTCCTTCTGGTGG TTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGATTTAATACGAGTTGTCGAATTGTTTGTAAAGTC TAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCTAATCTATTAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCCT TTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTC TCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTATTTTTAATGGCGATGTTTT AGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCTTACGCTTTCAGGTCAGAAGGGTTCTATCTCTGT TGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACTGGTGAATCTGCCAATGTAAATAATCCATTTCAGACGATTGAGCGTCAAAATGTAGGTATTTC CATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGT TATTACTAATCAAAGAAGTATTGCTACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCTCAGGA TTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTCAA AGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCG CTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTT TACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCA CGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGAAC CACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCC CGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGT TTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTA TGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGG

  • Scaffold of 5081NT

AATGCTACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCCAAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCT AATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTATATGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACAT GTTGAGCTACAGCATTATATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGAC CTGTTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATC CGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCA ATGAATATTTATGACGATTCCGCAGTATTGGACGCTATCCAGTCTAAACATTTTACTATTACCCCCTCTGGCAAAACTTCTTTTGCAAAAGCCTCTCGC TATTTTGGTTTTTATCGTCGTCTGGTAAACGAGGGTTATGATAGTGTTGCTCTTACTATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTT GAATGTGGTATTCCTAAATCTCAACTGATGAATCTTTCTACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGT CCTGACTGGTATAATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAAAGTTGAAATTAAACCATCTCAAGCCCAATTTACTACTCGTT CTGGTGTTTCTCGTCAGGGCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGATTTGGGTAATGAATATCCGGTTCTTGTCAAGATTACTCTTG ATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGTTCATCTGTCCTCTTTCAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCC TCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATGATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATA ATCGCTGGGGGTCAAAGATGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCGTTTTAGGTTGGTGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAA TGGAAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCC CGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTAT CAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAA AATTATTATTCGCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTA CTAACGTCTGGAAAGACGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAA CTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGG GTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAA ACCCCGCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTG TTTATACGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACG GTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCA ATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTT CCGGTGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGT CTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTG CTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCC TCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCT TTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGG TATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTATTGC TATTTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGG TGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGT TTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATA AAATTGTAGCTGGGTGCAAAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAA TACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTTGTTCTCGATGAGTGCG GTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTC TTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACTTTACCTTTTG TCGGTACTTTATATTCTCTTATTACTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATTAAGCCCTACTG TTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTTATTCTTATTTAA CGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTTCTCGCGTTCTTT GTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTATGATTTTGATA AATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATTTACAGAAGC AAGGTTATTCACTCACATATATTGATTTATGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTTTTCTTGATG TTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGAATCCGTT ATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCAAAT AATTTTGATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAA TATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGATTTA ATACGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCTAATCTATTAGTTGTTAGTGCTCCTAAA GATATTTTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGAT GCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGT TCGTTCGGTATTTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCTTACG
CTTTCAGGTCAGAAGGGTTCTATCTCTGTTGG

Staple

Staple of 4539NT
Start End Sequence
1[56]3[63]CAGCAGGCCGAGGTGCGGGCGCTA
1[90]3[95]AAATCGTGAACCATCGCTGCGC
1[115]3[127]AAAAGAATAGCCCAAAACCGTAATGCGCC
2[47]4[32]ACTAAATCGGAACCCTCAAGCGGTAAGAGTCT
2[79]4[64]TCAAGTTTTTTGGGGTGAAAATCCGTGTTTTT
2[111]4[96]GCGATGGCCCACTACGGCAAAATCTAGACAGG
2[143]4[128]CAACGTCAAAGGGCGAGAGATAGGGGAGCTAA
3[24]8[32]GCGAGAAAGGAAGGGATAGTCTTTCTTGCCTGGACTTTAC
3[64]8[64]GGGCGCTGACGTGGCACTTGCTGGTAGATAAT
3[96]8[96]GTAACCACATAGAACCCAGCCATTAGCACTAA
3[128]8[128]GCTACAGGCAGTAATAATACCTACAATTGAGG
3[144]0[144]TATGGTTGCTTAACGTGGACTCTTGTTCCAGTTCGTTGCGCTCA
4[31]7[31]GTCCATCATAACATCAAATGCGCGGAACCACC
4[63]7[63]ATAATCAGCTATCGGCCAGACAATGCGGTCAG
4[79]0[65]CCTGAGAATGTTTGATGGTCGGGGAGAGGCGGTTTGC
4[95]7[95]AACGGTACATTACCGCCTTCTGACCACGCTGA
4[111]0[97]AGGGATTTCCTTATAAATCGTGCCAGCTGCATTAATG
4[127]7[127]ACAGGAGGTCATGGAAAAAGGGACAAAGCATC
4[154]6[144]CCTCGTTAGAAGCTCAATCGTCGATTCACCAGT
5[16]8[16]ATTAGTAAAACTGATATACCGAACCGACAACT
5[48]2[48]AACTCAAATGAGGCCAAAAGGAGCCGTAAAGC
5[80]2[80]AGAACAATGCCAGAATAGCGGTCACACCCAAA
5[112]2[112]AAAAACGCCCGATTAACCGCGCTTCTATCAGG
6[47]0[33]ATGGCTATAGAAAGCGCCGAGTAACCACGCTGGGTTTTTCTTTTCAC
6[143]0[129]CACACGACGCGCGTACTCAGAGCGGTTGAGTGCTGCCCGCTTTCCAG
7[32]5[47]AGCAGAAGATAAAACAAAGTATTAAGTAGAAG
7[64]5[79]TATTAACACCGCCTGCGCCGTCAATAATATCC
7[96]5[111]GAGCCAGCAGCAAATGTCTTTAGGGCAACAGG
7[128]5[143]ACCTTGCTGAACCTCATTGAAAGGATTTTGAC
8[31]10[40]AAACAATTTTTAAAAGTTTGAGTAACATTATCGAAACAAT
8[63]10[72]ACATTTGAGAACAAAGAAACCACCAGAAGGAGAATATACA
8[87]3[79]AGATTAGAAACAGTGCCTGAAAGCGTAAGAATGCAAGTGT
8[95]10[104]CAACTAATTCATCATATTCCTGATTATCAGATATTGCGTA
8[119]3[111]CTAAAATAAAAAATCTATTCTGGCCAACAGAGCACACCCG
8[127]10[136]AAGGTTATTTCATCAATATAATCCTGATTGTTAAATTATT
9[16]11[23]TTATTAATTGCTTTGAAGGCGAAT
9[48]6[48]ATTTTGCGGGATTTAGGAGGTGAGATTTTTGA
9[144]7[154]TGGATTATACTCAAATCAACAGAATATCAAACC
10[39]15[39]AACGGATTCAAGACAATTTTTAACAGACGACG
10[71]15[71]GTAACAGTTATATTTTATTTATCATGCAGAAC
10[103]15[103]GATTTTCAATTTAATGTAGATTAAAGTCCTGA
10[135]15[143]TGCACGTAAATAAGGCCCCTTAGAAATTTACGAGCATGTA
11[40]14[40]CTGAGCAAAGACTACCAGAACGCGTTAGGCAG
11[72]14[72]AGAAAACAAATAGTGAAGTTAATTAATCGCCA
11[104]14[104]ATTTGAATCGATAGCTGTTTGAAAAAGCCAAC
11[136]14[136]ATAAATCATTAATTTTGTTAAATATCATATGC
12[55]10[48]GGTCTGAGAAGAAGATCATCGGGA
12[87]9[87]GAAGAGTCAAATTAATGTCAGATGCGGAATTA
12[119]9[119]AAACATAGTACCTTTTATAAAGAAGATGGCAA
13[24]11[39]TCCAATCGCGCCTGATTATTCATTTCAATTAC
13[56]11[71]TTTTCAAAACCTTTTAGATGAAACAAACATCA
13[88]11[103]TGACCTAAGGTTTAACTACATTTAACAATTTC
13[120]11[135]GTGTGATAAAACAGAATTAATGGAAACAGTAC
13[144]10[144]AGAATAAACACGTCGCTATTAAATATATGTGAGCTACCATATCA
14[39]16[32]AGGCATTTAAGCCTTAGCTTATCC
14[71]16[56]TATTTAACACCCAGCTGCGCCCAATAGCAAGC
14[103]16[88]GCTCAACAACGCTAACCCGTTTTTATTTTCAT
14[135]16[120]GTTATACAGCCAGTTAACCAAGTACCGCACTC
15[40]19[47]ACAATAAATATAGAAGAATCAAGAAAGTCAGACAATGAAA
15[72]17[79]GCGCCTGTTCATTACCACAATTTT
15[104]18[104]ACAAGAAACAAGCAAGGAGCGTCTAGAGAGAA
16[31]13[23]GGTATTCTAAGAACGCTAAAGTAAGTAATAAGGATGCAAA
16[55]13[55]AAATCAGACAACATGTCATGTAATAGAAAACT
16[87]13[87]CGTAGGAATTATCAACTAATTGAGTCATCTTC
16[119]13[119]ATCGAGAAAATAATATCCAGTATATACCGACC
16[143]19[143]GGTATTAACAAAATAATTAACGTCTAATAACG
17[24]12[16]AGGTTTTGTCGAGCCATTCTGTCCCTCCGGCTTAGGTTGG
17[56]12[56]TATTTTGCAACGCCAATCAGCTAAAAATCATA
17[88]12[88]TCTTACCAGTAGGGCTAATAGATAGACGCTGA
17[120]12[120]CCTAATTTAATTCTTACCCATCCTATCCTTGA
17[144]14[144]ACAGCCATATTTTCCAAGAACGGAAACCAATCACCTGTTTAGTA
18[79]21[79]TAGACGGGCCTTTTTACACGGAATCACCGACT
19[16]21[23]AAGCCCAACCAAAGACAGGGAGGG
19[32]17[23]GCAAGAAAGGGTAATTGAGCGCTAATATCAGACTTGCGGG
19[64]17[55]ACCGAAGCAGAATTAACTGAACACCCTGAACATTAGTTGC
19[96]17[87]AGCCGAACTAACATAAAAACAGGGAAGCGCATATCCTGAA
19[104]23[119]AAAGTTACGGTGGCAAGCAAAATCACCAGTAGCTTTTGATCAGACGAT
19[128]17[119]AAACGCAAAAAAATGAAAATAGCAGCCTTTACTTCCAGAG
20[47]23[55]GAAAATTCGAAATTATTCATTAAAGCCCGTATTCAGAGCC
20[63]22[48]TTTGTCACAATCAATATAGCAATATTTTCATA
20[87]24[72]AAAGACACAGAAAAGTCGGTCATAGCCCCCTTCCAGAGCCGGGGTCAG
20[127]22[112]AAAATACATACATAAACAGAAGGAGTCAGACT
20[143]22[144]ATGTTAGCAAGGCCGGAAACGTCACCATAATCAGTAGC
20[154]18[144]TATTACGCAGTGAATACCCAAACGATTTTTTGT
21[32]20[24]TATTGACGATATGGTTTACCAGCG
21[80]23[87]TGAGCCATGTTTTAACGCCGCCAG
22[23]25[23]ACCACCGGCCTCAGAATTCGGAACTTAAGAGG
22[47]25[47]ATCAAAATCACCACCCAAACAGTTGAAGGATT
22[111]24[104]GTAGCGCGAGGCAGGTGATACAGG
22[143]24[136]GACAGAATAAACAAATCGTTCCAG
23[24]22[32]CCGCCACCCTCAGAGCCACCGGAA
23[56]20[64]GCCACCAGAACCACCAATTAGCGTATCACCGTAAGTTTAT
23[88]20[88]CATTGACAGGAGGTTGTTTTCATCTAGAGCCACATATAAAAGAAACGC
23[120]20[128]TGGCCTTGATATTCACCAAGTTTGCCATTAGCAAACGTAG
23[144]26[144]AAATCCTCATTTCTGAATTTACAGGTTTAGTACCAGAACCGCCA
25[24]26[16]CTGAGACTGACAGCCCTCATAGTT
25[32]19[31]CCTCAAGAAATGCCCCCTGCCTATAAGGTAAACCAGAGCCTAATAAGA
25[64]19[63]TGCTCAGTTGCCTTGAGTAACAGTGGTGAATTTTGCCATCGCTATCTT
25[72]1[55]ACCAGGCGACTGAGTTTCGTCACCGTATTGGGCGCCAGGGTGTTTGCCC
25[96]19[95]AGGGTTGAAGTGTACTGGTAATAATTGGGAATGGCATTTTAAGCAGAT
25[104]1[89]TATAAGTAAGCAAGCCCAATAGGAAATCGGCCAACGCGGGTTCCG
25[128]19[127]TATCACCGTAAGCGTCATACATGGCACCATTACCTTTAGCAACCGAGG
25[136]0[115]TACTCAGGCCCTCAGAGCCACCACTCGGGAAACCTGTC
26[47]1[23]CCTGTAGCATTCCACACAGTGAGACGGGCAACACCTGAGAG
26[63]25[63]AGTACAAACTACAACGAGGATTAGCGGGGTTT
26[95]25[95]ACCCATGTACCGTAACGATAAGTGCCGTCGAG
26[127]25[127]CCTCATTTTCAGGGATTAGCCCGGAATAGGTG


Staple of 5081NT
Start End Sequence
1[24]4[16]TTGAATTATTCAAATATATTTTAGTTAATGGTCAGAACGC
1[56]3[63]AAATCAATCAATCGCATAAATAAG
1[90]3[95]GTAAATTATATAACTAGAAAAA
1[115]3[127]TCCCTTAGAATCCACTACCTTTACAAATT
2[47]4[32]AACGCGAGAAAACTTTCCTTTTTTACATGTTC
2[79]4[64]AATGCTGATGCAAATCATATGTGAAAGTAATT
2[111]4[96]CCGGCTTAGGTTGGGTCGTCGCTAAATAAGAG
2[143]4[128]ATCATAGGTCTGAGAGTTGAAAACTGTAATTT
3[24]8[32]TTGAAATACCGACCGTAGTTGCTATAATATCCGCAATAGC
3[64]8[64]AATAAACATGCGGGAGAACCAATCGCCCAATA
3[96]8[96]GCCTGTTTGAACGCGAATTCCAAGATCAGAGA
3[128]8[128]CTTACCAGATCAGATAACTCATCGTGAACAAA
3[144]0[144]CAACGCTCAACAATTTATCAAAAGCTTAGATTAAGTAACAGTAC
4[31]7[31]AGCTAATGAAGAAAAATTTTGCACGCGTCTTT
4[63]7[63]CTGTCCAGCATGTAGAGTTTTGAAAAATAAAC
4[79]0[65]AAAAGGTAGTGAATAACCTATCGCGCAGAGGCGAATT
4[95]7[95]AATATAAATCCTTATCGGCGTTTTAATAAGAA
4[111]0[97]GAGCCAGTTTAATTAATTTTCGCCTGATTGCTTTGAA
4[127]7[127]AGGCAGAGAGTACCGCTAGAAGGCATGAAAAT
4[154]6[144]ATATTTAACAACAAGCCGTTTTCGCGCCCAATA
5[16]8[16]TCCTGAACCCAGCTACGCTAACGACGAAGCCC
5[48]2[48]TTTACGAGACGACGACTAAGGCGTAGACAAAG
5[80]2[80]GCTGTCTTGTACCGACATAATTACTATATGTA
5[112]2[112]TTAAACCAGCATTTTCATGCGTTATTTAACCT
6[47]0[33]TCAAGATTGTGATAAAAATAAACAAATGGAAAGAGCAAAAGAAGATG
6[143]0[129]GCAAGCAATATAAAGCCGCCAACAATAGCGATCTTTTACATCGGGAG
7[32]5[47]CCAGAGCCTAATTTGCATGAAATACATCCTAA
7[64]5[79]AGCCATATTATTTATCTGAGTTAAAATAATCG
7[96]5[111]ACGATTTTTTGTTTAAGCGCTAATAACGGGTA
7[128]5[143]AGCAGCCTTTACAGAGGAACACCCAGAACAAG
8[31]10[40]TATCTTACAGTTACCAGAAGGAAACCGAGGAAAATTATTC
8[63]10[72]ATAAGAGCATAACGGAATACCCAAAAGAACTGCGATTGAG
8[87]3[79]ACAAGAATCCAATCCAAGCGAACCTCCCGACTCCGGAATC
8[95]10[104]GATAACCCAAGACTCCTTATTACGCAGTATGTCCAGCGCC
8[119]3[111]GTAATTGACGTCAAAATTATCCGGTATTCTAAAGTATCAT
8[127]10[136]GTCAGAGGGTAGAAAATACATACATAAAGGTGTGTCACAA
9[16]11[23]CCGAACAACACCGTCAGAGCCAGC
9[48]6[48]ACGCAATAAAGAAACACAGTTACAGCCTTAAA
9[144]7[154]GCAACATATAAGAGAATTAACTAGAATAACATA
10[39]15[39]ATTAAAGGGACGATTGAGAGCCGCGCCCGGAA
10[71]15[71]GGAGGGAAATCCTCATTCAGAACCGTTTAGTA
10[103]15[103]AAAGACAACTCTGAATCACCGGAATCAGAACC
10[135]15[143]TCAATAGAATGGCTTTTTCATAATATTTTCAGGGATAGCA
11[40]14[40]CCATTACCCCACCCTCGCCTTGATAGGATTAG
11[72]14[72]AATGAAACCGCCACCCTAAAGCCAAAAGTATT
11[104]14[104]TAGCGACAAGAGCCACTTACCGTTGCCTATTT
11[136]14[136]GACTGTAGGCCATCTTTGATGATAAACAGTGC
12[55]10[48]CAGAGCCAATTAGCAATTGACGGA
12[87]9[87]CTCAGAGCCATCGATACATTCAACGCATGATT
12[119]9[119]CCGGAACCGAATCAAGATGGTTTATAGCAAAC
13[24]11[39]GCAGGTCATGAATTATAAAATCACCAGTAGCA
13[56]11[71]ACAAATAAGGTAAATAGGCCGGAAACGTCACC
13[88]11[103]AGCGCAGTAAGGGCGAGCAGCACCGTAATCAG
13[120]11[135]CGTCATACAAATTCATTTTGCCTTTAGCGTCA
13[144]10[144]CAGGAGTGTACTATTAGCGTTTCGCGTTTTCATTAAGTTTATTT
14[39]16[32]GATTAGCGGAATTGCGTGGGATTT
14[71]16[56]AAGAGGCTATCTCCAACTTTCCAGACGTTAGT
14[103]16[88]CGGAACCTTAATTGTAATAGTTAGCGTAACGA
14[135]16[120]CCGTATAAGTGAATTTACAACGCCTGTAGCAT
15[40]19[47]TAGGTGTATTTCTGTAAATAATAAGAGGGTAGAATGCCAC
15[72]17[79]CCGCCACCTTTGTCGTAAAAAAGG
15[104]18[104]GCCACCCTCAGCCCTCTCGGTTTAGCAGGGAG
16[31]13[23]TGCTAAACAACTTTCAGGTTGATACTCAGTACAGGTTGAG
16[55]13[55]AAATGAATTCACCGTATCAAGAGAATTCACAA
16[87]13[87]TCTAAAGTCTCAGAACGAAACATGGAATGGAA
16[119]13[119]TCCACAGACAGAGCCATGCCCCCTCCAGTAAG
16[143]19[143]TACAAACTCTTAAACACGCATAACCAAAGTAC
17[24]12[16]AACTAAAGGGGTTTTGTAAGTATACACCAGAACCACCACC
17[56]12[56]CGTTGAAAGAGACTCCCTCAGGAGGCCACCCT
17[88]12[88]GGAGCCTTATTATTCTCGCCACCCCCGCCTCC
17[120]12[120]CTTTCGAGACAGTTAACCACCCTCCAAAATCA
17[144]14[144]GCTTGATACCGTTCGTCACCAGAGCCCAATAGGGTGCCTTGAGT
18[79]21[79]TCACCCTCAAGAGGCACCAACTTTCCCTGACG
19[16]21[23]TTCCATTAACCTTCATGATATTCA
19[32]17[23]AAATACGTCAACGGCTACAGAGGCTTTGAGGAAAAGGAAC
19[64]17[55]TAAAACGAAGCAGCGAAAGACAGCATCGGAACTTTTTTCA
19[96]17[87]CACTCATCTTAAAGGCCGCTTTTGCGGGATCGCTCCAAAA
19[104]23[119]TTTGACCCGCAGACGGTTGGGCTTGAGATGGTCAAAAATCGTTTAGAC
19[128]17[119]GCGCGAAACGATATATTCGGTCGCTGAGGCTTTCAGCTTG
20[47]23[55]CAGACCAGAACAAAGCTGCTCATTAAGAGGAATAAAAACC
20[63]22[48]ACAGATGAACGGTGTATACGAAGGATACCACA
20[87]24[72]CGAACTGAAAAGAATAAGGTAGAAAGATTCATTTTGCAAAAAAGCGGA
20[127]22[112]TTAGCCGGAACGAGGCCCAGCGATAATAAAAC
20[143]22[144]ACCTGCTCTCATTGTGAATTACCTTATTACCAGTCAGG
20[154]18[144]CGAAATCCGCGAACGGAGATTTACCATCGCCCA
21[32]20[24]ATCAACGTGCGCATAGGCTGGCTG
21[80]23[87]AGAAACACTCAGAAGCAGAAGTTT
22[23]25[23]CCAAAAGGCACTATCATTTTAATTGAAGCAAA
22[47]25[47]TTCAACTAGACGACGAGCCCGAAATTAGAGAG
22[111]24[104]GAACTAACAGTAAAATAGGTCTTT
22[143]24[136]ACGTTGGGCTGCGGAACAGAAAAC
23[24]22[32]TAACCCTCGTTTACCAATGCAGAT
23[56]20[64]AAAATAGCGAGAGGCTCAGTTGAGAAGGCTTGGAAAGAGG
23[88]20[88]TGCCAGAGGGGGTAATGGAACAACGTAGTAAATCAATCATAAGGGAAC
23[120]20[128]TGGATAGCGTCCAATAAAGAAAAAAACTTTAACATGTTAC
23[144]26[144]TCGTCATAAATTTTAAACAGTTTGCAACTAAAGATATAACAGTT
25[24]26[16]CTCCAACACATCAATTCTACTAAT
25[32]19[31]GGTCAGGAGACTTCAAATATCGCGTTACCCAAACATAACGAACGGGTA
25[64]19[63]TTTTGATATTGCATCAAAAAGATTCAGTGAATATTTAGGACACCAACC
25[72]1[55]AGAGGTCATAACCTGTTTAGCTATATTCATTTCAATTACCTCAGTACAT
25[96]19[95]AGAGCTTAACCCTGACTATTATAGCAGAACGAATTATTACCACTAAAA
25[104]1[89]ATTGCTGATTGACCATTAGATACATACCAAGTTACAAATGCTTCT
25[128]19[127]CAACATGTGAGAATGACCATAAATTTAATTTCTCTACGTTTATACCAA
25[136]0[115]TTTAAATAGATTCCCAATTCTGCGAAACAATAACGGAT
26[47]1[23]CGAGCTGAAAAGGTGGATGAAACAAACATCAAGAATTTCAT
26[63]25[63]ATTTTCATTTGGGGCGTACCTTTAATTGCTCC
26[95]25[95]TTTCGCAAATGGTCAATTTTTGCGGATGGCTT
26[127]25[127]AACGAGTAGATTTAGTATATAATGCTGTAGCT


Trials and errors

Initial design

Image:early_DNA_silks.png
▲Initial design of DNA silk

- Prepare ssDNA backbone via RCR. In it, red parts correspond to amorphous segments of spider silk and blue parts correspond to crystalline segments of spider silk.
- To turn DNA strands(blue parts) into a plate where DNA block would be attached, DNA oligos are added. Blue parts unconnected with oligos would form base pair with DNA origami block.
- Once DNA origami blocks are added, block-backbone structure is formed.

Idea to prevent gelation and bonding strands each other

Idea 1
Image:early1.jpg
- Connect Plates in each strands after reducing flexibility of DNA silk by attaching ssDNA oligomers
- Then detach ssDNA oligomers using ssDNA oligomers with fully complementary sequence

Idea 2

A segment : not attached to DNA origami plate, B segment : attached to DNA origami plate

- Oligomer has 1A'-2A'-3A' sequence in the ordered. In picture, ssDNA 1 from plasmid 1 has 1A-1B-1A-1B and ssDNA 2 from plasmid 2 has 2A-2B-2A-2B....
- By oligomers, each strand connects with one another

Idea 3
- Make it as fabric instead of thread. Electrospinning could be used for this process.

Others
Image:early4.png

Idea about crystalline segment

Structure of brick

1. All sides of trigonal prism are made from one scaffold.(composed of 1 strands.)

2. 3 sides made from other 3 scaffold with 1/3 scale.(composed of 3 strands.)


Idea 1-Rectangular plate(1)

6bp * 42 bp * 2layer = 504bp

Idea 2-Rectangular plate(2)

12bp * 42 bp * 2layer = 1008bp

Idea 3-Trigonal prism shaped brick(Honeycomb)
Image:141007_DNA_plate(Honeycom)_helix_Hjkim.jpgImage:141007_DNA_plate(honeycom)_Hjkim.jpg


Idea 4-Trigonal prism shaped brick(Square)

About 880bp, height : 80bp

Idea 5-Thick Trigonal prism shaped brick

About 2080bp, height : 80bp

Composition of BCC(Brick-Connector Complex) or Brick complex

Brick(Red) : Connector(Blue) = 3 : 1


Brick(Red) : Connector(Blue) = 3 : 3


Brick A(Red) : Brick B(Blue) = 3 : 3


Connecting location on brick & connector

Interlocking staple         Picture of linking state             Linking state by side view

1.
2.
3.

Red : Brick, Blue : Connector, Yellow : linking staple

We marked where brick and connector are connected by staple(figures above). Scaffold was used to check stability through cando progrem.

Personal tools