Matt Gethers/CRI, Thailand/Specifications/BT1736

From OpenWetWare

Jump to: navigation, search

Forward Primer BT2736 (5' to 3')

Extra Bases (For cutting efficiency) NdeI Site Annealing Bases
gcgcatatggaaaagaacagcagtccc

Specs

LENGTH (annealing/all): 21/27

GC CONTENT (not including non-anealing bases):47.6 %

MELT TEMP (not including non-anealing bases): 55.4 ºC

Min(ΔG): -0.07 kcal.mole-1

Stock Concentration: 100 μM

Personal tools