Matt Gethers/CRI, Thailand/Specifications/M13 Rev

From OpenWetWare

Jump to: navigation, search

M13 Rev

Sequence: 5' AGCGGATAACAATTTCACACAGGA 3'

LENGTH: 24

GC CONTENT: 41.7 %

MELT TEMP: 56.7 ÂșC

M13 pUC18 reverse primer (5' end at 498 on pubmed L09136 - look for reverse complement)

pUC18.gb

Personal tools