Mid-February 2010:

From OpenWetWare

Jump to: navigation, search

GenoCAD workflow and tutorial

 

Using the information gathered from analysis of the team wikis and provided design overviews; I attempted to recreate the designs using GenoCAD.

 

First priority was the creation of a comprehensive, exhaustive list of the parts that would be required for each system. Each entry contains the parts name, Biobrick part #, the part type, pertinent data for regulatory parts and links to sequence data and other supplementary data.

 

University Groningen

 

http://2008.igem.org/Team:Groningen

 

 

 

Part Name

Part #

Part Type

Length

Strength/efficiency

Sequence and supplementary info

TetR

R0040

Promoter

54

 

http://partsregistry.org/Part:BBa_R0040

PLuxR

R0065

Promoter

97

 

http://partsregistry.org/Part:BBa_R0065

mLuxR

?

Promoter

 

 

N/A

GFP

E0040

Protein

720

N/A

http://partsregistry.org/Part:BBa_E0040:Design

LuxI

C0061

Protein

618

N/A

http://partsregistry.org/Part:BBa_C0061

LuxR

C0062

Protein

756

N/A

http://partsregistry.org/Part:BBa_C0062

aiiA

C0060

Protein

786

N/A

http://partsregistry.org/Part:BBa_C0060

cI

C0051

Protein

 

N/A

http://partsregistry.org/Part:BBa_C0051

B0034

B0034

Ribosome binding site

12

1

http://partsregistry.org/Part:BBa_B0034

B0015

B0015

Ribosome binding site

129

0.98

http://partsregistry.org/Part:BBa_B0015

B0031

B0031

Ribosome binding site

14

0.07

http://partsregistry.org/Part:BBa_B0031

 

 

 

 

 

 

ULB Brussels

 

http://2009.igem.org/Team:ULB-Brussels

 

 

 

LacI Promoter

R0011

Promoter

55

 

http://partsregistry.org/Part:BBa_R0011

cI repressed promoter

R0052

Promoter

46

 

http://partsregistry.org/Part:BBa_R0052

HSL/P22 Hybrid promoter

K145150

Promoter

66

 

http://partsregistry.org/Part:BBa_K145150

LuxR/HSL promoter

R0062

Promoter

55

 

http://partsregistry.org/Part:BBa_R0062

HfsG

K196002

Protein

933

 

http://partsregistry.org/Part:BBa_K196002

HfsH

K196003

Protein

777

 

http://partsregistry.org/Part:BBa_K196003

parE

?

Protein

 

 

No biobrick part information but supplementary information on its function can be found here    http://www.ncbi.nlm.nih.gov/pubmed/12010492

 

 

 

 

 

 

University of Edinburgh

 

http://2008.igem.org/Team:Edinburgh

 

 

 

cenA

K118023

Protein

1353

 

http://partsregistry.org/Part:BBa_K118023

cex

K118022

Protein

1461

 

http://partsregistry.org/Part:BBa_K118022

bgIX

K118028

Protein

2280

 

http://partsregistry.org/Part:BBa_K118028

SU1

?

Protein

Sequence provided

 

http://2008.igem.org/Team:Edinburgh/SU1

ISO2

?

Protein

Sequence provided

 

http://2008.igem.org/Team:Edinburgh/ISO2

GBSS

?

Protein

Sequence provided

 

http://2008.igem.org/Team:Edinburgh/GBS1

glgC

K118015/K118016

Protein

1299

 

http://partsregistry.org/Part:BBa_K118015

E

?

Protein

 

 

Not an official biobrick part - supplementary information can be found here  http://jb.asm.org/cgi/content/abstract/171/8/4334

comK

?

Protein

 

 

Not an official biobrick part - supplementary information can be found here http://www3.davidson.edu/cms/Documents/Academics/Departments/InterdisciplinaryStudies/SimpsonSamanthaThesisOutline12-08pdf.pdf

PcstA

K118011

Promoter

131

 

http://partsregistry.org/Part:BBa_K118011

PcomK

 

Promoter

 

 

Not an official biobrick part

Plac

J33207

Promoter

600

 

http://partsregistry.org/Part:BBa_J33207

J15001

J15001

Ribosome Binding Site

10

 

http://partsregistry.org/Part:BBa_J15001

 

 

Following this step, was determining the presence of the parts used in these systems in GenoCAD’s database. Any parts not present in the database were created using GenoCAD’s custom part creation tools. From this point a library of the parts required to create these designs using GenoCAD. However, a number of caveats were initially observed with the program.

These included the inability to create multiple plasmids within the same design canvas. Also there is the inability to explicitly indicate relationship between parts comprising a single design. This is in part down to its nature as a sequence design tool predominantly. Also of note is the inability to place a single gene or multiple genes under the control of multiple promoters without user creation of composite parts. The latter issue being a result of the constraints involved in sequence design to prevent less experienced designers making fatal mistakes.

GenoCAD provides a structured system for the design of synthetic sequences. Based on the use of a set of “grammars” and a hierarchical construction workflow, GenoCAD constrains the possible structure of the synthetic sequences generated to a set of structures that could be functional in a biological context.

 

The first option presented to the user after the creation of their library of parts is to select the vector and flanking regions for the coding areas of the plasmid corresponding to their synthetic construct. Selection of the vector leads to a number of further options for the make-up of the expression cassette which in turn leads to further options. In essence, the construction metaphor is an inverted tree with an increase in options from top to bottom. After designing the basic structure of their synthetic construct the specific content for each type of part chosen is filled in. This content is what conveys the behavior of the actual system, more so than the structure of the system. 

The output of this tool is two-fold, the sequence of the synthetic system created and a graphical representation of the system created. An example system with a single negative feedback loop was created. GFP would be the primary output of this design, the levels of which are regulated by the levels of co-produced cI repressor protein. cI repressor protein would act on the cI repressor upstream of both the cI protein gene and GFP genes.

 

Diagram of example system.

 

The sequence corresponding to this construct as provided by GenoCAD can be found below:

{ggatcctaactcgaggttacattgtcgatctgttcatggtgaacagctttaaatgcaccaaaaactcgtaaaagctctgatgtatctatcttttttacaccgttttcatctgtgcatatggacagttttccctttgatatctaacggtgaacagttgttctacttttgtttgttagtcttgatgcttcact
gatagatacaagagccataagaacctcagatccttccgtatttagccagtatgttctctagtgtgaattcgcggccgcttctagagttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagaaagaggagaaatactagagatgcgtaaaggagaagaact
tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaa
tgctttgcgagatacccagatcatatgaaacagcatgactttttcaagtactagagaaagaggagaaatactagagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccag
gaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctactagagccaggcatcaaataaaacgaa
aggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagtagcggccgccctgcagg}

 

However, the sequences for the proteins, corresponding to the major functional elements and actuators of the expected behavior of the system are not included in this output. The sequences of regulatory elements are provided however.

 

 

Modelling of the behavior of a system based on known parameters and experimental data on the individual parts/elements of the system is an important part of the design process. GenoCAD was created to aid in the design process and creation of sequences for the chemical synthesis of these constructs, it is less concerned with the ability to test and/or predict functionality of the created systems in vivo. Due to this inability of GenoCAD to model synthetic systems and the need for such capabilities, we shifted our focus to locating more capable software tools in terms of design and modeling.

 

 

 

Personal tools