Muratore:Materials/Primers

From OpenWetWare

Jump to: navigation, search

Contents

BSA-NheI-5'

5'- CCC ACA AAA CTA TGG CTA GCA AGT GGG TGA CT -3'

PCR primer to insert BSA into IMPACT vectors

Tm = 69.5°C

Length = 32, LenPr = 15, MaxMM = 4

Priming to pCMV-SPORT6+BSA:

5'-CCCACAAAACTATGGCTAGCAAGTGGGTGACT-3'
   CCCACAAAACTGGCACAATGAAGTGGGTGACT priming site at position 161 forward

Tm = 52.5°C. Tpcr = 51.3°C.


BSA-SapI-3'

5'- TGG TTG GCT CTT CTA CGG GCT AAG GCT GT -3'

reverse PCR primer to insert BSA into IMPACT vectors

Tm = 71°C

Length = 29, LenPr = 15, MaxMM = 4

Priming to pCMV-SPORT6+BSA:

5'-TGGTTGGCTCTTCTACGGGCTAAGGCTGT-3'
   TGGTTGTGTCGTGTTTAGGCTAAGGCTGT priming site at position 1956 reverse

Tm = 41.4°C. Tpcr = 47.9°C.

ins_His_after_CBD

5'- CCT TGT GGC AGC TTC AAC ACC ACC ATC ATC ATC ACC ACC ACT GAC TGC AGG AAG GG -3'

Quikchange primer to insert His8 tag at C-term of Chitin binding domain tag in IMPACT vectors

Tm = 80.4°C

Length = 56, LenPr = 8, MaxMM = 2

Correct priming to pTXB1:

                     5'-CCTTGTGGCAGCTTCAACACCACCATCATCATCACCACCACTGACTGCAGGAAGGG-3'
GATGGGAACCATCCAACGTTCCTGCCTTGTGGCAGCTTCAA------------------------TGACTGCAGGAAGGG priming site at position 6570 forward

Tm = -0.8°C. Tpcr = 35.3°C.

Side-reaction priming to pTXB1:

5'-CCTTGTGGCAGCTTCAACACCACCATCATCATCACCACCACTGACTGCAGGAAGGG-3'
   AGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGG priming site at position 804 reverse

Tm = 3.7°C. Tpcr = 36.6°C.

Rins_His_after_CBD

5'- CCC TTC CTG CAG TCA GTG GTG GTG ATG ATG ATG GTG GTG TTG AAG CTG CCA CAA GG -3'

reverse Quikchange primer to insert His8 tag at C-term of Chitin binding domain tag in IMPACT vectors

Tm = 80.4°C

Length = 56, LenPr = 10, MaxMM = 2

Correct priming to pTXB1:

                        5'-CCCTTCCTGCAGTCAGTGGTGGTGATGATGATGGTGGTGTTGAAGCTGCCACAAGG-3'
   TCGGGCTTTGTTAGCAGCCGGATCCCCTTCCTGCAGTCA------------------------TTGAAGCTGCCACAAGG priming site at position 6539 revers

Tm = 20.1°C. Tpcr = 41.6°C.

Side-reaction priming to pTXB1:

5'-CCCTTCCTGCAGTCAGTGGTGGTGATGATGATGGTGGTGTTGAAGCTGCCACAAGG-3'
   GCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGG priming site at position 4620 forward

Tm = -3.6°C. Tpcr = 34.4°C.


Priming and melting/PCR temperatures are calculated using pDRAW

Personal tools