Notebook:Tk/2008/04/08

From OpenWetWare

Jump to: navigation, search

<<Prev | 2008/04/08 | Next>>

Contents

Primers for recT gene

  • gtttcttcgaattcgcggccgcttctagatgaataataaaattgaattaatattaaataattc,recT-F
  • gtttcttctactagtagcggccgctgcagttattaatcagaaaacatttcattaacagc,recT-R
  • gaaatgcaagaagcctatcaacatgaccaagcaataattattaataacagc,recT-mut-F
  • gctgttattaataattattgcttggtcatgttgataggcttcttgcatttc,recT-mut-R


Vector NTI file for recT mutated gene

  • from S. citri protein CAK99381
  • mutated to eliminate GATC site
  • biobricked, entered as part J70007 [[1]]
  • media:recT-SC.gb

Transformations

  • transform E. coli at 2.0 KV outgrow in 1 ml SOC rotated
    • plate out 100 μl at 1 hour/2.5 hour/3.5 hour
  • transform M. florum frozen cells
    • T1, perhaps sparked at 2.0 KV; outgrew anyway
    • T2, transformed at 2.0 KV without sparking
    • plated out 290 μl at 1 hour and 2 hour and 3 hour
    • Added 1 ul Tet to 300 ul culture at 2 hours for T1 and 1 hour for T2
    • Plated out both tet and non-tet added cultures for T1 and T2


Made electrocompetent cells

  • 5 ml and 500 ul seed culture tubes (50 ml final) grown 18 hours at 30C
  • Spin down, resuspend in 45 ml EPB
  • again
  • again, in 20 ml
  • spin down, resuspend in remaining liquid, bring to 250 ul
  • add 35 ul 80% glycerol
  • Aliquot to 50 ul tubes
  • flash freeze in EtOH + dry ice


iGEM Project name 1 Main project page
Previous entry      Next entry

Entry title

  • Insert your content here.


OpenWetWare Lab Notebooks are still actively being developed. Please use the Lab Notebooks Discussion page to suggest new features, report bugs, or ask questions.
Personal tools