Registry/Measurement kit/Notebook/2007-7-19

From OpenWetWare

Jump to: navigation, search

Contents

Primers

  • Creating new E0240 reverse primer for T9002: (NsiI)
    • TCAGCGAT ATGCAT TATAAACGCAGAAAGGCCCAC


  • Yesterday's PCR didn't work, as expected.
  • Made new ladder dilution:
    • 1µL ladder
    • 9µL water
    • 2µL loading buff

Sequencing results

  • Scarred: E0240 (9), I2057 (2, 4)
  • To be trashed: I2055 (3,4,16), E0240 (1,2)

I2055

  • Trying to add R0040 to I2055 by PCR.

F2620

  • Re-making overnight to sequence; last night's sample was lost.

Primer order

  • TCAGCGAT ATGCAT TATAAACGCAGAAAGGCCCAC, E0240_T9002_rev
  • 8-merR.NotI.EcoRI.CAGAAATCATCCTTAGCGAAAGC, BB_P_Rev_Eco
  • 8-merF.NotI.SpeI.TCACACAGGAAAGTACTAGATGCG, BB_E0240_Fwd_Spe
  • 8-merF.NotI.XbaI.TCACACAGGAAAGTACTAGATGCG, BB_E0240_Fwd_Xba
  • 8-merR.NotI.SpeI.GTGCTCAGTATCTCTATCACTGATAGG, BB_R_Rev_Spe
  • 8-merR.NotI.EcoRI.GTGCTCAGTATCTCTATCACTGATAGG, BB_R_Rev_Eco
  • 8-merF.NotI.XbaI.ATGCGTAAAGGAGAAGAACTTTTC, BB_I2055_Fwd_Xba
  • 8-merR.NotI.EcoRI.TTTATTCGACTATAACAAACCATTTTC, BB_T9002_Rev_Eco
  • 8-merF.NotI.EcoRI.TCACACAGGAAAGTACTAGATGCG, BB_T9002_Fwd_Pst
  • CTTAGTAG.CAATTG.tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactag.ATGCGTAAAGGAGAAGAACTTTTC , I2055_promoter_F
  • TCAGCGAT.ATGCAT.TATAAACGCAGAAAGGCCCAC, E0240_R
  • 8-merF.NotI.XbaI.ATGGCTTCCTCCGAAGACG, BB_I2056_Fwd_Xba
  • 8-merF.NotI.SpeI.TCACACAGGAAAGTACTAGATGGC, BB_I2057_Fwd_Spe
  • 8-merF.NotI.XbaI.TCACACAGGAAAGTACTAGATGGC, BB_I2057_Fwd_Xba
  • also need to make ccdB primers...
Personal tools