Registry/Measurement kit/Notebook/2007-7-20

From OpenWetWare

Jump to: navigation, search

Primers

  • Making primers for P1010 (Fwd: 54.0, Rev: 52.9)
  • Eco, fwd
    • CTTAGTAG GAATTC ACTGGCTGTGTATAAGGGAGCC
  • Xba, rev
    • TCAGCGAT TCTAGA ACGCGTGGATCCGGC
  • Spe, fwd
    • CTTAGTAG ACTAGT ACTGGCTGTGTATAAGGGAGCC
  • Re-ordering "E0240_R" for I2055/promoter PCR
    • TCAGCGAT ATGCAT TATAAACGCAGAAAGGCCCAC
  • I2055+promoter
    • CTTAGTAG CAATTG tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactag ATGCGTAAAGGAGAAGAACTTTTC
  • T9002_E5501_R (E0240 without terminators)
    • TCAGCGAT ATGCAT TTATTATTTGTATAGTTCATCCATGCC
Personal tools