Rm1, RASSL Based on hMC4-Receptor

From OpenWetWare

Jump to: navigation, search

Rm1:

This is the RASSL Melanocortin No. 1. The sequence is identical to hMC4R except for the L106P substitution that renders it a Gs-coupled RASSL. Rm1 has a lower basal activity than the wild-type receptor by ~ 30%.

gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgcc gcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgag caaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttaggg ttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattg actagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccg cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattga cgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgg gtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtac gccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgacct tatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatg cggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtct ccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaat gtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctat ataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatac gactcactatagggagacccaagctggctagttaagcttggtaccgagctcggatccactag tccagtgtggtggaattgcccttatcaattcagggggacactggaattcgcccttgcctatc tagaataaacgctcaactttggcagatccaccATGGACAGCAAAGGTTCGTCGCAGAAAGGG TCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCCGA TTACAAAGATGATGATGATGTCGACTCCCCGATCCAGATCTTCCGCGGCATGGTGAGCAAGG GCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGC CACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAA GTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTGACCT ACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCC GCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAA GACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCA TCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCAC AAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCA CAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCG ACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGAC CCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCT CGGCATGGACGAGCTGTACCGGATCCTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGC TACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGG TGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGC ATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCA AATGGATCAGAAACCATTATCATCACCCCATTAAACAGTACAGATACGGATGCACAGAGTTT CACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTT GCAGCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCAT AACATTATGACAGTTAAGCGGGTTGGGATCAGCATAAGTTGTATCTGGGCAGCTTGCACGGT TTCAGGCATTTTGTTCATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCA TGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGG CTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTGCCAATAT GAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCT TCCTCCACTTAATATTCTACATCTCTTGTCCTCAGAATCCATATTGTGTGTGCTTCATGTCT CACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGC ACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAG GCCTTTGTGACTTGTCTAGCAGATATTAAatggggacagagcacgcaatataggaacaaagg gcaattctgcagatatccagcacagtggcggccgctcgagtctagagggcccgcggttcgaa ggtaagcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcacca tcaccattgagtttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctg ttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcc taataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtgg ggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcgg tgggctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcg ccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacact tgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccg gctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacgg cacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgata gacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaa ctggaacaacactcaaccctatctcggtctattcttttgatttataagggattttggggatt tcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtgg aatgtgtgtcagttagggtgtggaaagtccccaggctccccaggcaggcagaagtatgcaaa gcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcaga agtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccat cccgcccctaactccgcccagttccgcccattctccgccccatggctgactaatttttttta tttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttt tttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctga tcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctc cggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctct gatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacct gtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgg gcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattg ggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccat catggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccacc aagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggat gatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcg catgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatgg tggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctat caggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccg cttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttc ttgacgagttcttctgagcgggactctggggttcgcgaaatgaccgaccaagcgacgcccaa cctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcg ttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcc caccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaattt cacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtat cttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtcatagctg tttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaa gtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgc ccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcgggg agaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggt cgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaat caggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaa aaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcg acgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctg gaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgccttt ctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgta ggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgcct tatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagca gccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtg gtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccag ttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggt ggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatccttt gatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtca tgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatca atctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacc tatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataa ctacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgc tcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtgg tcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagta gttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgc tcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatc ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagt tggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgcca tccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtat gcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaa ctttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccg ctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttac tttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataa gggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttat cagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatagg ggttccgcgcacatttccccgaaaagtgccacctgacgtc

Personal tools