SBB09Ntbk-VaiUmesh
From OpenWetWare
JCAnderson 13:51, 2 February 2009 (EST)
Today I learned how to change a wiki page and made my pages.
Vaibhavi Umesh 2 February 2009 (EST):
- Recieved project ball --> OmpX - Learned how to change a wiki page - Made/edited personal page
Circularly Permuted ompX
Source: E. coli MG1655 genomic DNA
Before starting design, you should read this tutorial:
A Guide to Circular Permution
In general, you should clone the bits and pieces out of genomic DNA first, subclone and sequence those bits,
then assemble them into full length in a separate step. You can use either SOEing as described in the tutorial to do
the assembly, or use standard assembly.
The reference for linker composition of eCPX is: PMID: 18480093
This part encodes a N-terminal display protein
Your displayer part should be of the {<part!} style (no start, with stop). There should be NO prepro sequence in your part.
You should design your construction file to insert your part into plasmid pBca9495KC-Bca1144#5 using EcoRI and BamHI.
Things to do
- Make wiki notebook page - Make personal page - Read about circularly permuted plasmids - Read paper about OmpX - Begin working on construction file to design OmpX basic part
*Vaibhavi Umesh 4 February 2009 (EST):
- Everyone in class got Project Balls <br> - Worked on Construction files for OmpX
Vaibhavi Umesh 6 February 2009 (EST):
- Worked on designing oligos and the construction file for the project parts
Vaibhavi Umesh 9 February 2009 (EST):
- Worked on designing oligos and the construction file for the project parts - This is what I designed based on reading the paper Chris had suggested:
1) Native N-terminus - OmpX {N.ompX!}
PCR VU015F/VU016R on OmpX (529 bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, 2057+910, L)
Product is M10012 {N.ompX>}
-------------------------------------------
VU015F Construction of OmpX N term part
ccaaaGAATTCatgAGATCTatgaaaaaaattgcatgtctttcagcactggccgc (40% GC content, length = 55 bp)
VU016R Construction of OmpX N term part
gcaaaGGATCCttaaccggcaatccaggtgcctacg (56% GC content, length = 36 bp)
---------
2) Native C-terminus - OmpX {
AGATCTgttggttaccgcttctaaGGATCC
EIPCR VU017F /VU018R on pBca9145-Bca1144#5 (2090 bp, BglII)
Product is M10013 { --------------------------------------------
VU017F EIPCR construction of {C.OmpX>} ccataAGATCTgttggttaccgcttctaaGGATCCtaaCTCGAGctgcag
VU018R Reverse BglII oligo for His6 EIPCR CCAATAGATCTcatgaattccagaaatc
-------------
Assemble the complete part by SOEing
Criteria for Linker between N and C terminus:
From the paper, I was able to extract the following information:
* The linker should be 6 peptides long
* The first peptide should be Glycine
* The third and sixth positions were restricted to R/K/S/H/Q/N
* The substitution A165V resulted in improved display scaffolds
* The substitution G166S resulted in improved display scaffolds
* The display enhancing substitutions A165V and G166S are located immediately upstream of the native C-terminus of OmpX
* The remaining positions (2 and 4) should be randomized
keeping all this in mind I thought the following linker would be best suited:
GSKNVS
which has a nucleotide sequence of: GGTTCTAAAAATGTTTCT
New N junction
gttggttaccgcttc
New C junction
aaaaaaattgcatgtctttc
Forward Oligo:
Linker.C junction
GGTTCTAAAAATGTTTCTaaaaaaattgcatgtctttc
Reverse Oligo:
N junction.Linker
gttggttaccgcttcGGTTCTAAAAATGTTTCT
Reverse Complement:
AGAAACATTTTTAGAACCgaagcggtaaccaac
PCR VU019F /VU016R on M10012 (527 bp, gp A)
PCR VU017F/VU020R on M10013 (44 bp, gp B)
PCR VU021F /VU016R on gp B + gp A (553 bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, 2057+910, L)
Product is M10014 { -------------------------
VU019F Forward SOEing oligo for cpOmpX
GGTTCTAAAAATGTTTCTaaaaaaattgcatgtctttc
VU020R Reverse SOEing oligo for cpOmpX
AGAAACATTTTTAGAACCgaagcggtaaccaac
VU021F Forward construction of C.OmpX
ccataAGATCTgttggttaccgcttcGGTTCTAAAAATGTTTCT
Note: VU021F had to be used instead of re-using VU017 because VU017 was used to construct {C.OmpX>} through EIPCR
Vaibhavi Umesh 10 February 2009 (EST):
- Project parts were due --> Contruction files - Oligos will be ordered this week - Chris said he would go through all the construction files and make corrections as necessary.
Vaibhavi Umesh 11 February 2009 (EST):
- Chris corrected the construction files:
1) Native C-terminal portion of ompX {N.ompX}
PCR Ovu015/Ovu016 on MG1655 gen. (322bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L)
Product is pBca9145-M10012 {N.cpx}
-----------------------------------------------------------
Ovu015 Construction of OmpX N term part
ctagaGAATTCatgAGATCTGGTCAGTCTggtgactacaacaaaaaccag
Ovu016 Construction of OmpX N term part
gacaaGGATCCgaagcggtaaccaacagaggcaatccaggtgcctac
2) Native N-terminal portion of ompX {C.ompX}
PCR Ovu017/Ovu018 on MG1655 gen. (196bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L)
Product is pBca9145-M10013 {C.cpx}
-----------------------------------------------------------
Ovu017 Construction of OmpX C term part
ctagaGAATTCatgAGATCTgcgacttctactgtaactgg
Ovu018 Construction of OmpX C term part
gacaaGGATCCttaagagcttgcagtacggcttttctcgg
3) SOEing assembly of eCPX
PCR Ovu015/Ovu019 on pBca9145-M10012 (334bp, EcoRI/BamHI = A)
PCR Ovu020/Ovu018 on pBca9145-M10013 (194bp, EcoRI/BamHI = B)
PCR Ovu015/Ovu018 on A+B (505bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L)
Product is pBca9495KC-M10014 {<eCPX!}
-----------------------------------------------------------
Ovu019 SOEing of eCPX
gtcgcTTTAGACTGTTTAGATCCgaagcggtaaccaacag
Ovu020 SOEing of eCPX
GGATCTAAACAGTCTAAAgcgacttctactgtaactgg
Vaibhavi Umesh 18 February 2009 (EST):
- Started Project! - Oligos came in - diluted all of them - 100 uM - Set up a PCR reaction
PCR
(Regular PCR Protocol): 24uL ddH2O 3.3uL 10x Expand Buffer "2" 3.3uL dNTPs (2mM in each) 1uL Oligo 1, 10uM 1uL Oligo 2, 10uM 0.5uL Expand polymerase "1" 0.5uL Template DNA
Vaibhavi Umesh 23 February 2009 (EST):
- Ran an analytical gel to make sure pcr worked - Did a zymo clean up on the PCR product to obtain the required fragments - Digested the fragments with EcoRI and BamHI (according to the construction file) - Cleaned up the digest * Did not have time to finish ligating and transforming. So, Digests were stored in the freezer until the next lab period
GEL:
- 5ul sample + 1ul dye - ladder: 3-5ul - run at 100V for about 20 minutes
REGULAR ZYMO CLEANUP:
1. Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction (min. is 3 volumes) 2. Transfer into the Zymo column (small clear guys) 3. spin through (15 secs at max speed, ie around 15,000 rpm), discard waste. 4. Add 200 uL of PE or Zymo Wash buffer (which is basically 70% ethanol) 5. spin through, discard waste. 6. Add 200 uL of PE or Zymo Wash buffer 7. spin through, discard waste. 8. spin for 90 seconds, full speed to dry. 9. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
DIGEST:
*Set up the following reaction: 8uL of eluted PCR product 1uL of NEB Buffer 2 0.5uL EcoRI 0.5uL BamHI *Incubate at 37 degrees on the thermocycler for 1hr *Run an agarose gel, and melt with 600uL ADB buffer at 55 degrees. *If the DNA is shorter than 300bp, add 250uL of isopropanol and mix prior to loading it on the column
Vaibhavi Umesh 25 February 2009 (EST):
- Ligated the digests from the last lab period - Feb 23rd - Transformed them into DH10B cells and put the plates in the incubator
LIGATION
*Set up the following reaction: 6.5uL ddH2O 1uL T4 DNA Ligase Buffer (small red or black-striped tubes) 1uL pBca9495AK-Bca1144 1uL Insert digest 0.5uL T4 DNA Ligase *Pound upside down on the bench to mix *Give it a quick spin to send it back to the bottom of the tube *Incubate on the benchtop for 30min *Put on ice and proceed to the transformation
TRANSFORMATION
Competent cells are stored as 200uL aliquots in the -80 freezer as a communal stock 1. Thaw a 200 uL aliquot of cells on ice 2. Add 50 uL of water 3. Add 30 uL of KCM salts 4. Put your ligation mixture on ice, let it cool a minute or two 5. Add 75 uL of the cell cocktail to the ligation, pipette up and down gently to mix 6. Let sit on ice for 10 min 7. Heat shock for 2 min at 42 8. Put back on ice for 1 min 9. For ampicillin selection, you can plate immediately, otherwise: 10. Add 100uL of LB, let shake in the 37 degree incubator for 40 min 11. Plate on selective antibiotics, let incubate overnight
Vaibhavi Umesh 27 February 2009 (EST):
- Colonies were picked and grown out for us over the weekend - Today: Miniprepping!!! - I had a total of 4 miniprep samples: 2 of each kind (The N and C termini) - After miniprepping, a restriction mapping was performed to see if the samples should even be sent to the sequencing facility. - Restriction mapping: Worked! - Did not have time to send the samples for sequencing today - Will do them on the next lab period
MINIPREP PURIFICATION OF DNA
1. Pellet 1.5 mL saturated culture by spinning full speed, 30 seconds. 2. Dump supernatant, repeat to pellet another 1.5 mL (for a total of 3 mL) 3. Add 250uL of P1 buffer into each tube. Resuspend the cells using a vortexer. 4. Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). Gently mix up and down. Solution should become clearer. 5. Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to precipitate, and leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake. 6. Spin in centrifuge at top speed for 5 minutes. 7. Label blue columns with an alcohol-resistant lab pen. 8. Pour liquid into columns, and place the columns into the centrifuge. Spin at 12000 rpm for 30 seconds. 9. Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin) 10. Wash each column with 500 uL of PB buffer. 11. Spin in centrifuge at 12000rpm for approximately 15 seconds, then flick out the liquid again. 12. Wash with 750uL of PE buffer (washes the salts off the resins). 13. Spin in centrifuge at 12000rpm for approximately 15 seconds and flick out liquid again. 14. Spin in centrifuge at full speed for 1 minute to dry off all water and ethanol. 15. Label new tubes and put columns in them. 16. Elute them by squirting 50uL of water down the middle of the column (don't let it stick to the sides). 17. Spin in centrifuge at top speed for 30 seconds. 18. Take out columns and cap the tubes. 19. Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature.
RESTRICTION MAPPING
3uL of miniprep DNA 5ul H20 1uL of NEB Buffer 2 0.5uL EcoRI 0.5uL BamHI *Incubate at 37 degrees on the thermocycler for 1hr *run out on a gel to check size (should be 2974bp, 282bp)
Vaibhavi Umesh 2 March 2009 (EST):
- Samples were sent in for sequencing - However, to avoid wasting time, the 3rd part of the construction file - SOE-ing PCR was started today - N and C termini constructs were not verified to be correct - But only the PCR was set up such that if the first two constructs were wrong, only the SOE-ing PCR step would be a waste
Vaibhavi Umesh 4 March 2009 (EST):
Did not come into lab - Sick
Vaibhavi Umesh 6 March 2009 (EST):
- Today was a short day: - Sequencing results came in - they worked! The first two constructs of the N and C termini were correct
Vaibhavi Umesh 9 March 2009 (EST):
- Since the first two constructs were verified to be correct, I proceeded with SOE-ing PCR - Performed a zymo clean up of the PCR - Did a restriction digest - Ran the samples on a gel and gel purified the required fragments (cut out the bands with a razor before purification) - Once fragments 'A' and 'B' were obtained (check construction file), a second PCR was set up with the SOE-ing oligos on A+B
Vaibhavi Umesh 11 March 2009 (EST):
- The PCR with A+B was purified and digested with EcoRI and BamHI - Ligation was set up - The construct was transformed into DH10B cells
Vaibhavi Umesh 13 March 2009 (EST):
- Today was a very short day: - I picked a colony from the plates I had transformed and put it into the Shaker - (Gabe said he would monitor the test tubes + miniprep my samples over the weekend) - Plan - To send the samples in for sequencing first thing on Monday
Vaibhavi Umesh 16 March 2009 (EST):
- Sent sample in for sequencing. Nothing left to do except wait to see if it worked - If it didnt, trouble shooting will begin!
Vaibhavi Umesh 18 March 2009 (EST):
- Sequencing came in: Clone was correct!!! - The circularly permuted OmpX part (eCPX) was successfully made
Vaibhavi Umesh 20 April 2009 (EST):
Assigned Assay - Cell-cell adhesion
Plan: - To transform RFP into DH10B cells - These cels would be plated on Spec plates' - Colonies would be picked from these plates and cultures grown - they would be co-transformed with the IILK and AG4 plasmids - We will also make clones without the RFP plasmids
Vaibhavi Umesh 21 April 2009 (EST):
Jennifer did the following: - Picked colonies into 24 well plate - Used 3mL LB total pBca9495CA-(M10218-M10225) - A1 --> D1 - A2 --> D2 pBca9495CA-(M10210-M10217) - A3 --> D3 - A4 --> D4 pBca9495CA-Bca1363 - A5 pBca1600-Bca1144 (RFP plasmid) - B5
Vaibhavi Umesh 22 April 2009 (EST):
- Performed 1:10 Dilutions - 96-well plate: 1 mL of LB (with or without arabinose) and 100uL of saturated cell culture. - In the V-bottom plate: 300uL of LB (with or without arabinose) and 30uL of saturated cell culture. - The V-bottom plate would allow us to qualitatively assess whether any flocculation occurred. - The 96-well plate was used because RFP measurements could easily be made using the Tecan.
Vaibhavi Umesh 27 April 2009 (EST):
- Due to inconclusive results, certain parts were re-transformed. - The idea of co-transforming with RFP was not used. - Instead, it was decided that sodium hydroxide could be used to get rid of cell clumps from flocculation - Breaking up the clumps was necessary to obtain an accurate concentration of cells.


