SIL072006-Construction of pSB1A2-J23015

From OpenWetWare

Jump to: navigation, search

F plasmid with OriT knockout
PCR FORlamF/ForlamR on pKD3 (~1000bp, dPN1, Neb2)
Electroporate into pKD46xpOX38
Product is pSB1A2-J23015


ForlamF Forward oligo to knockout OriT:
tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
ForlamR Reverse oligo to knockout OriT:
ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa

Personal tools