Stanford/BIOE44:Module3:Day2: Toluene

From OpenWetWare

Jump to: navigation, search

Home        People        Schedule        Key Info.        OWW Basics       
DNA Engineering        Devices        Synthesis        Baking        Testing


Toluene/TCE Sensor

Authors: Sunny Kim, Alejandro Virrueta


Purpose

To create a novel biosensor that senses both toluene and trichloroethylene (TCE) and generates a colored pigment as an indicator of their presence in the environment.


Rationale

Environmental .


Long Description

The device is designed to express a color gene as a result of the presence of mercury in water. merR, from Thermus thermophilus HB27, expresses a promoter repressor protein that binds to the promoter region of the mer operon, repressing transcription. In the presence of mercury, the mercury ions bind to the repressor proteins which unbind from the promoter and as a result initiate transcription. In the device, a color generator will be placed downstream of the promoter and merR so that in the presence or mercury, transcription initiates and color is expressed.

The mer operon is in HB27 is composed of the promoter region, OAH/OAS sulfhydrylase, MerR, and Mercury Reductase. Sulfydrylase and Mercury Reductase are irrelevant for our design, but literature states that the promoter region is found 69 bp upstream the sulfhydrylase sequence. In searching for the promoter sequence, we isolated 200 bp upstream of the sulfhydrylase and used BCM Search Launcher to predict the location of the promoter. Standard restriction enzyme sites of the BioBricks Standard 10 were not found in the promoter and merR sequences, so modification of the DNA was not needed.


Short Description

The gene sequences of the promoter region and merR of the mer operon in T. thermophilus HB27 will be placed upstream of color generator gene. Color will be expressed in the presence of mercury.


Promoter Sequence

Link: http://www.ncbi.nlm.nih.gov/nuccore/AB042508.1


Ptod, modified with hangs. No restriction site changes. TodX Coordinates: 14325..15686

gaattcgcggccgcttctagag GCATAAACCATCGTTTATCACAGTTAAACTTTGGTTTTCTAAGTTGCGATAGCCATATAAACCCATAAGCCAAAAAACAATATTTCCCAGGGCGTGATTGTAATACTGTGCGTGCT tactagtagcggccgctgcag


Toluene/TCE Sensitive Transcriptional Regulator Protein Sequences

Link: http://www.ncbi.nlm.nih.gov/nuccore/Y18245.1


TodS, modified with hangs. Changes: 1 EcoRI, 2 PstI. Coordinates: 11292..14228.

gaattcgcggccgcttctag ATGAGCTCCTTGGATAGAAAAAAGCCTCAAAATAGATCGAAAAATAATTATTATAATATCTGCCTCAAGGAGAAAGGATCTGAAGAGCTGACGTGTGAAGAACATGCACGCATCATATTTGATGGGCTCTACGAGTTTGTGGGCCTTCTTGATGCTCATGGAAATGTGCTTGAAGTGAACCAGGTCGCATTGGAGGGGGGCGGGATTACTCTGGAAGAAATACGAGGGAAGCCATTCTGGAAGGCGCGTTGGTGGCAAATTTCAAAAAAAACCGAGGCGACCCAAAAGCGACTTGTTGAAACTGCATCATCCGGTGAATTTGTTCGCTGTGATGTTGAGATTCTTGGAAAATCAGGTGGAAGAGAGGTAATATCGGTCGATTTTTCATTGCTGCCAATTTGCAATGAAGAAGGGAGCATTGTTTACCTTCTTGCGGAAGGGCGCAATATTACCGATAAGAAGAAAGCCGAGGCCATGCTGGCGTTGAAGAACCAGGAATTGGAGCAGTCGGTTGAGTGTATCCGAAAACTCGATAATGCGAAGAGTGATTTCTTTGCCAAGGTGAGCCATGAGTTGCGCACTCCGCTGTCTTTGATTCTAGGCCACTGGAAGCCGTTATGGCGGGCAGAGGCTGGGCGTGAATCGCCGTATTGGAAGCAGTTTGAGGTCATTCAGCGTAATGCAATGACCCTGTTGAAACAGGTTAACACGCTGCTTGACTTGGCGAAAATGGACGCCCGGCAGATGGGGCTTTCCTATCGGCGAGCCAATCTTAGTCAGCTCACCCGTACTATTAGCTCGAATTTTGAAGGAATAGCCCAGCAAAAATCAATAACGTTCGATACAAAACTGCCTGTACAGATGGTCGCTGAGGTGGATTGTGAGAAATACGAACGCATTATCCTTAACTTGCTTTCCAATGCGTTTAAATTCACCCCTGACGGGGGGCTTATCCGTTGCTGTCTTAGTTTGAGTCGACCAAATTATGCCTTGGTTACTGTATCTGATAGCGGGCCGGGTATTCCTCCTGCACTGCGTAAAGAAATATTTGAACGTTTCCACCAGCTAAGCCAGGAAGGTCAACAAGCTACGCGGGGTACAGGCTTGGGGCTTTCCATTGTGAAAGAGTTCGTTGAATTGCACCGTGGAACAATTTCTGTAAGTGATGCCCCGGGCGGGGGGGCGCTTTTTCAGGTAAAGCTGCCGCTGAATGCTCCTGAAGGTGCTTATGTTGCGAGTAACACCGCGCCGCGAAGAGATAATCCTCAGGTCGTGGATACGGATGAGTACCTTTTGCTGGCGCCCAATGCGGAAAATGAAGCCGAGGTGCTTCCATTTCAATCCGACCAGCCTCGGGTGCTAATCGTTGAAGATAACCCTGATATGCGTGGTTTTATAAAGGACTGTCTCAGTAGCGACTATCAAGTTTATGTTGCACCCGACGGTGCAAAGGCATTGGAGTTGATGTCAAACATGCCGCCAGACCTGTTGATTACAGACCTGATGATGCCTGTTATGAGCGGCGATATGCTGGTTCACCAAGTGCGTAAGAAAAATGAACTTTCACATATCCCGATCATGGTGCTGTCGGCCAAGTCAGACGCAGAACTGCGTGTGAAATTGCTCTCCGAGTCGGTGCAGGACTTTCTTCTTAAGCCATTTTCTGCTCATGAGCTACGAGCGCGTGTAAGCAATCTGGTATCCATGAAGGTGGCAGGCGATGCGTTGCGTAAGGAGCTTTCCGATCAGGGGGATGATATTGCGATACTTACTCACCGTCTGATCAAAAGTCGCCATCGTCTTCAGCAGAGTAACATCGCATTATCCGCCTCGGAAGCGCGTTGGAAAGCAGTGTATGAAAACTCTGCGGCCGGTATTGTACTGACCGACCCGGAAAACCGAATACTCAACGCCAATCCTGCATTTCAACGCATTACCGGATATGGGGAAAAGGATTTGGAGGGACTTTCCATGGAGCAATTGACTCCATCTGACGAAAGCCCACAGATAAAGCAGCGTCTGGCCAATTTGCTTCAGGGTGGGGGAGCGGAATACAGTGTGGAGCGCTCCTATCTATGCAAAAATGGTTCTACGATTTGGGCCAATGCGAGTGTCTCGCTGATGCCTCAACGTGTCGGTGAATCTCCAGTTATACTCCAGATCATCGATGACATCACTGAGAAGAAACAAGCACAGGAAAATCTTAACCAATTGCAGCAACAACTTGTGTACGTTTCCCGATCAGCTACGATGGGTGAATTTGCAGCCTATATTGCACACGAGATAAACCAACCGCTCTCGGCGATCATGACCAATGCCAATGCTGGCACACGTTGGTTAGGTAATGAGCCATCTAACATCCCAGAGGCTAAAGAGGCACTGGCTCGCATTATCCGAGATTCCGACCGCGCCGCAGAAATTATCCGTATGGTACGCTCCTTCCTGAAGCGTCAAGAAACGGTGCTGAAACCGATTGATCTAAAAGCACTGGTAACTGATACAAGCCTGATACTTAAGGCCCCTAGTCAGAATAACAGTGTCAATTTGGATGTTGTTGCGGATGATGAACTCCCTGAGATATGGGGGGATGGTGTACAGATCCAGCAGTTGATAATAAATCTGGCTATGAACGCTATTGAAGCGATCAGCCAAGCCGACTGTGAAACCAGGCAGCTAACCCTGTCATTCTCAGGCAATGATACAGGTGATGCGCTTGTTATCTCAGTGAAAGATACAGGTCCAGGTATTTCAGAGAGGCAGATGGCGCAGTTGTTCAACGCATTCTACACCACAAAAAAAGAAGGGCTTGGTATGGGATTGGCAATCTGTCTTACAATCACGGAAGTGCATAACGGTAAAATATGGGTTGAGTGCCCGCCCGCTGGGGGTGCTTGTTTCCTGGTAAGTATCCCTGCCAGACAGGGCTCCGGCACATAA tactagtagcggccgctgcag


TodT, modified with hangs. Changes: 1 XbaI. Coordinates: 14162..14845.

gaattcgcggccgcttctag ATGCCCGCCCGCTGGGGGTGCTTGTTTCCTGGTAAGTATCCCTGCCAGACAGGGCTCCGGCACATGAGTGATCGGGCATCTGTTATCTATATCCTCGATGACGACAATGCAGTACTGGAAGCACTGAGCAGCTTGGTGCGTTCAATCGGCCTGAGTGTCGAGTGTTTTTCATCCGCTAGCGTATTCCTGAACGATGTCAATCGCTCTGCCTGTGGCTGTCTAATTTTGGATGTCCGTATGCCCGAGATGAGCGGGTTGGATGTGCAACGACAACTGAAAGAGCTTGGCGAGCAAATCCCCATTATTTTTATCAGCGGCCACGGTGATATTCCGATGGCAGTCAAAGCGATCAAGGCGGGTGCGGTAGACTTCTTCACTAAACCTTTTCGAGAAGAGGAGCTGCTTGGCGCTATTCGCGCCGCGCTGAAGTTGGCGCCCCAGCAGAGATCAAACGCTCCCCGAGTCAGCGAGCTTAAAGAGAATTACGAAAGCCTCAGCAAACGCGAGCAACAGGTGCTTAAGTTCGTCTTGCGAGGATATCTAAACAAGCAGACGGCCCTAGAGCTTGATATATCGGAAGCAACAGTGAAAGTGCACCGCCATAATATCATGAGGAAAATGAAAGTATCTTCAATCCAGGATCTGGTTCGAGTAACTGAGCGGCTCAAGGATAGCCTGGAATAA tactagtagcggccgctgcag


References

Two levels of cooperativeness in the binding of Todt to the tod operon

Lacal J, Guazzaroni ME, Gutierrez-del-Arroyo P, Busch A, Ve´ lez M, Krell T, Ramos JL, J Mol Biol 2008, 384:1037-1047.

Hierarchical binding of the TodT response regulator to its multiple recognition sites at the tod pathway operon promoter

Lacal, J., Guazzaroni, M. E., Busch, A., Krell, T. & Ramos, J. L. J. Mol. Biol 2008. 376, 325–337.


Tools

ApE http://www.biology.utah.edu/jorgensen/wayned/ape/

BCM Search Launcher: Gene Feature Searches http://searchlauncher.bcm.tmc.edu/seq-search/gene-search.html
Personal tools