TChan/Notebook/2007-3-15

From OpenWetWare

Jump to: navigation, search

Sequence -> Dr.'s Orders

  1. Megablast BLAST (link)
    • INPUT: sequence
    • OUTPUT: NT_030059.12
  2. Search Entrez SNP
    • INPUT: NT number
    • OUTPUT: refSNP
  3. Search OMIM
    • INPUT: reference SNP number
    • OUTPUT: SNP info
  4. Read papers and decide what course to pursue with your paper

Mystery Sequence

>mystery
TAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTC
CTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGT
TAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGA
CATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCC
GGTCAACTTCGAGCTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGC
CGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGT
GCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGC
CTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTC
TGAGTGGGCGGC
Personal tools