Talk:20.109(S15):Diagnostic primer design (Day2)

From OpenWetWare

Jump to: navigation, search

Enter your primer sequences here: The 'bp' column refers to where your primers start and end in the ClustalW alignment file. We need this information so we can double check the sequences before ordering. We don't want a typo to keep your experiment from working!

Team (T/R) Forward primer name Forward primer sequence (5'-->3') Bp Reverse primer name Reverse primer sequence (5'-->3') Bp
Orange FINAL Orange Avian Influenza A Matrix Forward CAGCGATTCAAGTGATCCTCTCG Orange Avian Influenza A Matrix Reverse GGTACTCTTCCCTCATAGACTCAGG BP
Yellow Final Yellow Avian Influenza Detection Primer Forward 5’- GTTCTCTCTATCRTYCCRTCAGGC-3’ Yellow Avian Influenza Detection Primer Reverse 5’- CYTTAGTCAGAGGTGACARGATTGGT-3’ Primer Positions
Green Green Team AIV Forward Primer GCAGCGATTCAAGTGATCCTC Green Team AIV Reverse Primer GRTACTCYTCCCTCATAGACTCAGG Image:Green team.jpg
Blue FINAL Superior Team Blue Influenza A Forward Primer GGATCAAGYGARCAGGCAGC Superior Team Blue Influenza A Reverse Primer GAATCGCTGCATCTGCACTCC Image: TeamBluePrimers.jpg
Purple FINAL Purple Infuenza diagnostic primer forward GGT RCA GGC AAT GAG RAC AAT TGG Purple influenza diagnostic reverse CTG CAT YTG CAC TCC CAT TCG

Team (W/F) Forward primer name Forward primer sequence (5'-->3') Bp Reverse primer name Reverse primer sequence (5'-->3') Bp
Yellow FINAL Yellow AIV Matrix Primer Forward GCAGCGATTCAAGTGATCCTC 21 Yellow AIV Matrix Primer Reverse ACTCYTCCCTCATAGACTCAGG 22
Blue Blue AIV Matrix Forward Primer 5’-GGCTAAAGACAAGACCAATCCTG-3’ 23 Blue AIV Matrix Reverse Primer 5’—CCATTTAGGGCATTCTGGACAAAGC-3’ 25 Image
Pink Pink Avian Influenza A Matrix Forward Primer AAGCTAGACAGATGGTGCAG 20 Pink Avian Influenza A Matrix Reverse Primer AGGATCACTTGAATCGCTGC 20
Purple FINAL Purple AIV Forward CGTTCTCTCTATCRTYCCRTCAG [L=23, 3' @ 77] Purple AIV Reverse TYCCYTTAGTCAGAGGTGACARG [L=23, 3' @ 178]
Personal tools