TdTomato

From OpenWetWare

Jump to: navigation, search

Sequence

atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac atcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatc cccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttc gaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacgctgatc tacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcagaagaag accatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc gagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagacc atctacatggccaagaagcccgtgcaactgcccggctactactacgtggacaccaagctg gacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggc cgccaccacctgttcctggggcatggcaccggcagcaccggcagcggcagctccggcacc gcctcctccgaggacaacaacatggccgtcatcaaagagttcatgcgcttcaaggtgcgc atggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccc tacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcc tgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgcc gacatccccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatg aacttcgaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacg ctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcag aagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctg aagggcgagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttc aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa

Reference

  1. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, and Tsien RY. . pmid:15558047. PubMed HubMed [Tsien]
Personal tools