Template:Original EILD part sequence

From OpenWetWare

Jump to: navigation, search

GTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGTCTGAAATCTACCACCTGGACAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGTGAACGTGGTGGTTGC

Personal tools