User:Aijah Raghnal/Notebook/Biology 210 at AU

From OpenWetWare

Jump to: navigation, search

Search this Project

Customize your entry pages

Project Description/Abstract

Zebrafish Lab

The Effects of Caffeine on Embryonic Development of Zebrafish

Research Question: What are the effects of caffeine on the development of zebrafish embryos?

Hypothesis: We hypothesize that the caffeine will result in zebrafish with shorter body lengths, slower embryonic development, and less active motor neurons.

Zebrafish Lab: Day 7- February 26, 2016

Goals for Today

-Put in fresh water into each well

-Remove empty egg cases

-feed the larvae

-Preserve 1 to 3 embryos from the control and the experimental groups in paraformaldehyde.

-Observe representative embryos/larvae from each plate with the compound microscope and depression slide.


Materials and Methods

We began the lab by making observations of each embryo. Going through each well, we checked to see which ones were still alive and if there were any developmental deformities that were occurring. In order to see which fish were alive, we provided a stimulus for movement. For some larvae, no stimuli was needed, and for others, it was not until we had drawn the pipet near that they were encouraged to move. This occurred more often with the experimental embryos. After making our observations, we took a closer look at three embryos under a light microscope at 4x magnification. From the control group, we chose row 2, column 5, and row 3, column 2. From the experimental group, we chose row 2, column 4. We looked for a number of aspects under the microscope. It included the body and tail pigmentation, eyes and eye movement, heartbeat, pectoral fin development, swim bladder, mouth development, and any general movement. After recording our observations of each fish, we chose which two embryos we would be preserving. Upon choosing experimental row 3, column 1, and row 3, column 2 control, we prepared each for preservation. We inserted each embryo into its own small glass seal-able tube. We then added 1 mL of tricaine anesthetic to each tube and waited sufficient time for the embryo to be fully asleep. Once they were in a deep sleep, we added 4 mL of paraformaldehyde to each tube. Each tube was then stored.


Notes

Below is a graph of our observations on the life status of each embryo

Image:rsz_2rsz_1rsz_20160227_180559.jpg


Observations under the light microscope

Image:rsz_1rsz_20160229_222652.jpg

Image:rsz_1rsz_20160229_222657.jpg

Zebrafish Lab: Day 4- February 24, 2016

Goals for Today

-Observe which embryos are alive and which ones are dead

-Make observations of mutations, development, any movement etc.

-Feed the developing fish


Materials and Methods

We began by retrieving our zebrafish plates and observing them under a dissection microscope to determine stages in growth, which ones appeared alive, and which ones were dead. We were also looking for any differences between embryos from the control group, and embryos from the experimental group. After sketching out a chart in which the observations of each zebrafish would go, we observed each embryo under the microscope, marking any mutations, developmental delays, and slight movements. After taking note on the forty-eight embryos, we fed each one 15 micro liters of brine shrimp food. The plates were then re-lidded and left for Day 7.


Notes

Below is are the written observations of each zebrafish.

Control group

Image:rsz_1rsz_1rsz_20160225_213039.jpg


Experimental group

Image:rsz_1rsz_1rsz_1rsz_20160225_213050.jpg

Zebrafish Lab: Day 1-February 19, 2016

Goals for Today

-Plan out our experiment

-Plate the zebrafish embryos


Materials and Methods

Today, our main focus was setting up our experiment. After choosing the drug caffeine to test on the zebrafish embryos, and reading the scientific study, Movement disorder and neuromuscular change in zebrafish embryos after exposure to caffeine, conducted and written by Yau-Hung Chen, Yi-Hui Huang, Chi-Chung Wen, Yun-Hsin Wang, Wei-Li Chen, Li-Chao Chen, Huey-Jen Tsay, we set up our experiment. We were allotted two plates, each with twenty-four wells. One plate was dedicated for the control group while the other was for the experimental. The control group would be placed into wells of distilled water, while the experimental group would be placed into wells of varying concentrations of caffeine. We settled on four different concentrations of caffeine: 25% caffeine/distilled water mix, 50% caffeine/ distilled water mix, 75% caffeine/ distilled water mix, and 100% caffeine solution. The caffeine solution itself holds 40mg/L which is about 40ppm (parts per million) of caffeine. There are six wells for each of the four concentrations of caffeine. Once all forty-eight wells were filled with their appropriate liquid, we moved onto the task of ensuring that each zebrafish embryo was around the same stae of development. We did this by looking at each one under a dissecting microscope. After this was completed, we carefully pipetted each embryo into its own well. After this was done, we placed the lids on each plate. Our hope for his experiment is to compare the effects of the zebrafish embryos due to caffeine, compare the ppm of the caffeine concentrations to the ppm of caffeine in popular caffeinated drinks, and discuss the harm that it might have on human embryos.


Notes

Below are some notes that we took in preparation for our experiment. The small chart on the right hand side of the picture is the set up of our experimental group's plate

Image:rsz_1rsz_1rsz_20160225_004142.jpg


February 26, 2016- 16S Sequencing Data

Description

Earlier on in the lab, we ran a PCR of two colonies of bacteria that we had gown on our agar plates/ agar+ tetracycline plates. Because we did not label our results to be analyzed, the sequencing of our bacteria was not there. In order to still have a sequence to work with, we looked to previous Biology 210 students. Cosette Brianna, a Biology 210 student in Spring 2015, worked with the same transect as us, the garden transect. In using her sequencng, we can analyze bacteria that grows within our transect.

Data

The following sequences are taken from Cosette Brianna's work with bacteria within our garden transect.

23-- >MB92-Rev_16S_G03.ab1 NNNNNNNNNNNNNANNNNANNGCGCCNTNCNNGCAGCTACTNNNNNNNACTTCTGGAGAGACGGCTCGACGGGTGNGGTG TGCGNGNGTAGGAGACCCGTCANCGTATTCTTGGTGACATTCTGATACAAGATTACCAGCGATCCCGACTTCNAGTTGTC GACTTGCATACTGCCAGCCAGAGGACTACAGGGATTGTGGGATTAGCTCCCCCTCGCGGGTTGGCAACCCTNTGTACCAN CCATTGGAGGACGTGTGGAGCCCCGGCCATAAAGGACATGAGGACTTGACCTCCTCCCCCCCTTCCTCCGGTTTGTCACC GGTAGTCCCCTTANAGTGCCCAACTGAACGTAGCAACTAATGGGGAGGGTTGGTTGCGTTGCTTGACTTAACCCCCCATC TCACGACATGANCAGACGACTGCCACGCCGCATCTGTGGGCTGGTAGGCTTTCAAGGACCCAACCCTCTTTGGTAACTTT CTGCCCTGGGAAAGGTGGGTAAGGTTTTTCCCGTTTAATCCAAATAAACCACATCATGCGCCGGTTGTGGGGGTCCCCGT TGATTCTCTTTATTTTCAACCTTGTCGCCGTGCTCCCCACGTGGTGCATTTTATNCGATACTTTCNGTACTGAGTCANCT NAGACCCATCANCCTTTTGACATNGNTTAAGGAGGGGANNANCNCGGGNTCTATTCCNGCTTTNTCCCCNCNCTTTNNCG CNAGAACNTCANTGAGCTGCCNNGGNANTGCCNTCTCCATCAGTGATCCNCNCNNTATATACCCACTTGTCTGATTCNGC CGGAATTNCATCCCCCCCCTGCCCCACNNTATCCTTGCNNTGCNATGGTNGAGCCCCCGTNGATCNCCNNNANTTTNANN NTNTNNNNANNCACCCCNGCGCNCGCTATATNCNCATAAATTTNAAATANNCNTATTCCCNCNNCTTTTNNGCNGGGNGN NGGGNNAANNNTNANNCTGTNCTTATTNTTNNNNNNNNNNNNNNANNNNGGGNTATTNNNGNNNNNCNTCTNNTTNCNNN NNNANNACANTAAAANNNCANNNCCNCGNCNGCNNNNGCTTTGCTGNTTGNNNNNTTTNNNNNNNNNNNACANNNCGCNN NN

Uncultured Comamonas sp. clone 127 16S ribosomal RNA gene, partial sequence


24-- >MB93-Rev_16S_H03.ab1 NNNNNNNNNNNNNNCNNANNNNNCTNNNGTTACGCGTCACCGACTATCNAGTACCCGGTACTTCCNTGGCTTGGCGGGCG GTGTGTACAGGGCCCGGGAACGTATTCACCGCGCCATGGCTGATGCGCGATTACTATCGATTCCAACTTCAAATAGTCGA GTTGCAGACTCCAATCCGAACTGAGACCAGCTTTCGATATTTGGGATTGGCTCCTGTGTAGCTGCCCTCTGTACTGGCCA TTGTATTACGTGTGAGGCGCGAGGCCTAAGGGCCGTGGTGATTTAACATCTTCCCCACCTTCCTCTCTACTTGCGTATGC CGTCTCACTACACTCCCCAACTTAATGATGGAAACTATTGAGAGGGGGTGCGCTCGTTGCGCGACTTAACCTAACACCTC ACGGCACGAGCTGACAACAACCATGCGCCACCTTGGAAAATGTCCNAACAAGAGTCTATTTCTAAACCTGTCATTTCCCA TTTANGCCTTGGGGAGGTTCCTCGCGTATCNNCGAATTAAACCACATAATCCACCGCTNGTGCGGGGCCCCGTCNATTCC TTTGANTTTCATTCTTGNNNNNGTACTCCCCACGTGGCTNACTTATCACTTTCNCTTANTCTCTGAATCCNAANATCNAA AAACNAGTTANCATCGTTTACAGCGTGNACTACCAGGNNATCTAATCNTGTTCGCTCNCCACGCTCTCNTCCATCANCGT CANNNGTTGCTTAGTAACCTGCCNTCGCAATTNNNGTTCTNAGTAATATCTATGCATTTCACCGCTACNCTACNTATTCC CGCTACTTCAACAACACTCAANACCTGCANTATCAATGGCAGTTTNANANTTAANCTGTGAGATTTCACCACTGACTTAT NTATCCNCCTACAGACCCTGTANACNCTATANATCCNGANNANNCTAGCACCNTCCGCANTACCNCTACTGCTGGNACGG AGTTNGCNNNGTGCNTATTCNTATANTNNNTTCAGCTANCATNCACNTANCTNGGTNNNTNCCCTATNNANNNNNNTTTA NGACCNATAGGGNCNNCGNCCNTCANNCNNNATGGCTGGATCAGGNTNGCANNCATTGNGCANTANNCCNNNNNTNNNGA NNNNNNN Chryseobacterium sp. JCM 10535 gene for 16S ribosomal RNA, partial sequence


AKR~

February 12, 2016- Invertebrates and Vertebrate Analysis

Description

In continuation of making observations of our transect, this week, we used the Berlese funnel to take a closer look at the soil invertebrates within our transect. We also took a look at acoelomates, pseudocoelomates, and coelomates under dissecting microscopes.

Materials and Methods

We began the lab by observing acoelomates, psuedocoelomates, and coelomates, under the various dissecting microscopes set up. Specifically, we viewed a cross sectional slide of a nematode (pseudocoelomate), an earthworm (coelomate), and live planaria (acoelomate). After observing several anthropods under microscopes, we moved on to our Burlese funnel. In order to observe the invertebrates within our Berlese funnel (and therefore our transect), we removed the tube of the 50% ethanol and organisms from the funnel. Pouring 15ml into one petri dish and pouring the remainder into a second perti dish, we were able to view the organisms under a dissecting microscope. With the aid of a dichotomous key, we identified each organism.


Data

The following is a chart describing, naming, and quantifying five organisms found from the Berlese funnel of our transect. Note: As the dissecting microscope used did not have an ocular lens, nor a way to mark the level of magnification, it was difficult to document the length of each invertebrate in mm.

Image:rsz_1rsz_20160218_134431.jpg


Vertebrate Analysis

While we did not make observations of vertebrates within our transect, using the data collected of organisms residing in the transect, we made a hypothesis of the vertebrates that may also share the space. The analysis consists solely of birds because the tall gate surrounding our transect would prove a difficult barrier for tetrapods to pass.


Possible vertebrates within the transect:


Killdeer (Charadrius vociferus)

Image:rsz_1rsz_killdeer.jpg

Image courtesy of Enclopedia of Life http://eol.org/pages/1049356/overview


Phylum- Chordata

Class- Aves

Order- Charadriiformes

Family- Charadriidae

Genus- Charadrius

Species- Charadrius vociferus


This species would benefit from the soil invertebrates as its diet consists of them. The gate surrounding the transect would be of benefit to these birds, too. When scavenging for invertebrates in the soil, they can be less concerned abut potential predators. The tree at the far end of the transect can also provide cover in case a predator does somehow come by.


American Woodcock (Scolopax minor)

Image:rsz_1rsz_american_woodcock.jpg

Image courtesy of Encyclopedia of Life http://eol.org/pages/1049378/overview

Phylum- Cordata

Class- Aves

Order- Charadriiformes

Family- Scolopacidae

Genus- Scolopax

Species- Scolopax minor


The species would benefit in a similar way to the Killdeer. American Woodcock eat a variety of invertebrates and would thus also benefit from the biotic factors within the transect. In addition, the color of the birds will blend in especially well to the abiotic wooden plots and wood chips layered across the transect.


Yellow-billed Cuckoo (Coccyzus americanus)

Image:rsz_12058_580_360.jpg

Image courtesy of Encyclopedia of Life: http://eol.org/pages/915103/overview

Phylum- Chordata

Class- Aves

Order- Cuculiformes

Family- Cuculidae

Genus- Coccyzus

Species- Coccyzus americanus


Similar to the Killdeer and the American Woodcock, the Yellow-billed Cuckoo would benefit from similar abiotic and biotic factors. Although these birds are usually found in more forest type areas, considering that American University is situated somewhat near to Rock Creek Park, it can be safe to assume that these birds may still find residence at our transect. This is especially plausible considering that the presence of humans in Rock Creek Park may hinder them from finding invertebrates within the soil in comparison our transect: a largely undisturbed community garden nestled far from heart of campus.


American Kestral (Falco sparverius)

Image:rsz_1rsz_11744_580_360.jpg

Image courtesy of Encyclopedia of Life: http://eol.org/pages/1049171/overview

Phylum- Chordata

Class- Aves

Order- Falconiformes

Family- Falconidae

Genus- Falco

Species- Falco sparverius


American Kestrals often make their home in agricultural habitats. In addition, they feed on invertebrates. Since they feed diurnally, and the transect is gated off, they would not have to worry about any predator that may attack. The American Kestral can also find shelter in the large tree at the northern end of our transect.


House Sparrow (Passer domesticus)

Image:rsz_30523_580_360.jpg

Image courtesy of Encyclopedia of Life: http://eol.org/pages/922241/overview

Phylum- Chordata

Class- Aves

Order- Passeriformes

Family- Passeridae

Genus- Passer

Species- Passer domesticus

The House Sparrow feeds on seeds, so a garden with flowering plants would satisfy their food needs. The wood chips on the floor of the transect could also potentially work as camouflage. A gate would hinder some potential predators and the House Sparrow could also make its home in the large tree that overlaps the transect.


Food Web of our Transect

Image:rsz_1rsz_food_web.jpg


This food chart represents the balance that must exist between the organisms within our transect. As a community, they maintain the structure of their ecosystem. If there was ever too many of one organism, carrying capacity would be reached and their environment could no longer support them all. For example, say that there was an influx of secondary trophic level organisms that relied on primary level trophic organisms for sustenance. The primary trophic level would suffer because they would be devoured at a much faster rate. Less of these organisms means a lesser food supply for the species that has reached carrying capacity. They will begin to die off as well until balance has been achieved. It is in this way that the balance of the ecosystem is maintained, allowing for all of the organisms to flourish in controlled growth.


Conclusions

Our data shows that out of the five invertebrate organisms that we had found, four of them shared the same phylum and class. This was especially interesting in that each of these organisms largely differed in appearances. Looking at the ratio, this suggests that phylum arthopoda dominates the types of invertebrates that exist in or transect. In addition, our data suggests that there is variety within the title. Considering that each of the organisms we saw were widely different, perhaps the invertebrates adapted to their specific niche within the transect. Completing this lab added an additional layer of understanding to our transect. There is now a more complete picture of the ecosystem of our transect and its biodiveristy.

AKR~

February 5, 2016- Plantae and Fungi

Description

In this lab, we took a closer look at the plants within our transect with the purpose of better understanding aspects such as plant vascularization and specialized structures. In addition we observed fungi to better understand what fungi sporangia are, and why they are important. The goal is to specify which genus the plants belong to.


Materials and Methods

Taking two plastic bags, we revisited the transect in order to collect a total of 500 grams of leaf litter for the Berlese Funnel that we would be putting together later in the lab. In addition to the leaf litter, we collected five different types of leaves to represent the transect as a whole. After returning to the lab, we closely observed the five leaves for types of vascularization and their specialized structures. We, additionally, examined the mechanisms of plant reproduction by analyzing the plants we collected. After this, we inspected different types of fungi under a dissecting microscope and classified them into one of the three groups (the groups being zygomycetes, basidiomycetes, and ascomycetes). After drawing a picture of one of the fungi and stating why we have reason to believe that it is one, we finished up the lab by setting up the Berlese Funnel. This funnel will be used to collect invertebrates for the lab next week.


Data

Plantae


Image:rsz_1rsz_1rsz_20160205_100147.jpg

Plant 1

Location (in transect):In the cabbage patch

Description:Large, green, holes

Vascularization: vascular

Specialized Structures:very large, waxy, firm

Mechanisms of Reproduction:seeds

Seed type: dicot



Image:rsz_1rsz_20160205_100551.jpg

Plant 2

Location: In one of the wooden plots used for growing produce.

Description: medium-small, green leaf

Vascularization: vascular

Specialized Structures: bumpy, fuzzy texture, firm

Mechanisms of Reproduction: seeds

Seed type: dicot



Image:rsz_1rsz_20160205_100726.jpg

Plant 3

Location: On the ground towards the back end of the transect

Description: small, green

Vascularization: vascular

Specialized Structures: small, waxy, very smooth in appearance, clustered

Mechanisms of Reproduction: seeds

Seed type: dicot



Image:rsz_1rsz_20160205_100831.jpg

Plant 4

Location: Along the fence

Description: Thin stems, many narrow leaves

Vascularization: vascular

Specialized Structures: very skinny, smooth, waxy, flexible

Mechanisms of Reproduction: seeds

Seed type: monocot


Image:rsz_2rsz_20160205_101003.jpg

Plant 5

Location: Front of transect near the entrance

Description: deep maroon with patches of brown, medium-small in size

Vascularization: vascular

Specialized Structures: bumpy, rigid, different colors

Mechanisms of Reproduction: seeds

Seed type: dicot


Fungi

Image:rsz_1rsz_1rsz_20160211_023301.jpg

Above is a drawing of a type of fungus. Listed next to the drawing are its descriptions. It is believed to be a fungus because the white fuzzy cloud over the bean matches the description of hyphae filaments as they grow over a surface. In addition, a closer look under a microscope reveals what appears to be sporangia.


Conclusions

While it was difficult to conclude what the genus of each plant was, we were able to gain much more information on them than we had gained on our first trip to the transect. This experiment was conducted in order to gain a better understanding of the plantae in general: plant vascularization, the role of specialized structures, and the mechanisms of reproduction. This experiment was also purposed for us to better understand fungi, specifically fungi sporangia. Considering that life on Earth blossomed due to the emergence of photosynthetic plants, it is necessary that time is taken to better understand how they have evolved as well as their significant role today. Similarly, fungi is found and used for a myriad of things, and yet little time is taken to fully comprehend their importance. More than just for flavor in food or a good beer, fungi similarly play a crucial role in maintaining space for organisms to grow and flourish on Earth among other other crucial functions.

January 29, 2016- Hay Fusion Culture Observations

Description

We observed bacterial cells taken from our Hay Infusion Culture with naked eye, and under a microscope, and stained.


Materials and Methods

At the end of the previous lab, we inoculated four nutrient agar plates, and four nutrient agar and tetracycline plates (for a total of eight plates) with a combination of increasingly diluted sterile broth (10^-2, 10^-4, 10^-6, and 10^-8) and liquid from the hay infusion. After a week, we collected our eight plates and observed the colonies that formed on each plate, with a naked eye. Following this, we selected two nutrient agar plates and two nutrient agar and tetracycline plates to use for the gram stain. Sterilizing a loop over a flame, we gently scraped up some bacteria and mixed it with the a drop of water placed on a slide. Then, using a red crayon, we drew a circle around where the bacteria was so we would have a reference where the bacteria remained after the water evaporated. To evaporate the water, we wafted it over a flame, close enough for the water to dry, but far enough for the bacteria to not die off. We repeated the process for each of the remaining three plates. Following the gram stain procedure, we then stained each slide with the appropriate dye for an appropriate amount of time. After patting each slide dry, we moved them to a light microscope for further observation. We, additionally, made wet mounts for each of the four plates as well. The procedure was much like the first steps in the gram stain procedure. We sterilized a loop over a flame, scraped up some bacteria, and mixed it with a droplet of water on a slide. This was repeated for the remaining three plates.

Data

Hay Infusion Culture Observations Our Hay Culture Infusion had not changed much. There was still no pungent smell associated with it. Smell may change week to week based on organisms growing a dying within the culture. Appearance may change for a similar reason. Archaea probably did not grow on the agar plates as archaea organisms grow in extreme environments.


Table 1: 100-fold Serial Dilutions Results

Image:rsz_1rsz_20160205_013958.jpg

The colony types are similar between plates with tetracycline and those without, however, significantly less colonies grew on the plates with tetracycline. On these plates, many of the types of colonies found on the plates without the antibiotic, were not present.The bacterial colonies that grew on these plates were, therefore, ones where a mutation was developed that provided immunity to the antibiotic.After natural selection, this left significantly less bacterial types, and bacterial colonies on the plates with tetracycline. Eventually, every bacterial species was affected as on the two plates with the least diluted form of tetracycline, no bacterial colonies survived.

Nutrient Agar Plates

Image:rsz_1rsz_20160129_094247.jpg Image:rsz_1rsz_20160129_094308.jpg


Image:rsz_1rsz_20160129_094314.jpg Image:rsz_1rsz_120160129_094255.jpg


Nutrient Agar + Tetracycline Plates

Image:rsz_1rsz_20160129_094202.jpg Image:rsz_1rsz_20160129_094217.jpg


Image:rsz_1rsz_20160129_094225.jpg Image:rsz_1rsz_20160129_094236.jpg


Gram Stain

Image:rsz_1rsz_1img_0292.jpg Image:rsz_1rsz_1img_0294.jpg

  • Gram Positive


Image:rsz_1rsz_1rsz_img_0291.jpg Image:rsz_1rsz_img_0295.jpg

  • Gram Negative

Based on our observations, it is difficult to tell which mechanism of action tetracycline uses. Whether gram negative or gram positive, and whether tetracycline was included or not, bacteria was found in abundance.


Conclusion

In conclusion, we found that there was a large diversity of bacteria within our Hay Infusion Culture. While it was difficult to tell exactly what types of bacteria were present, it was visible even with the naked eye. We did this experiment in order to fully grasp the diversity found among bacteria, not only in our Hay Infusion Culture, but in general so in this way, our expectations were met. On the agar plates without tetracycline, a wide array of distinct bacterial colonies grew. As for the agar plates with tetracycline, it is clear that the more diluted the antibiotic, the more able bacterial cells within our Hay Infusion Culture (who have evolved to withstand the effects of the tetracycline), to survive and grow. Natural selection took place, and the bacterial cells who did not develop this mutation were not able to survive to pass on their genes. This experiment is important because it is necessary to have an understanding of the microorganisms that share this world with us. In addition, these microorganisms are, not only a window into understanding the past, but a key part in the progress of medicine for the future.

There were aspects to this lab that we were unable to complete, and in consequence, our results are a bit vague. In the future, a more complete lab experiment (on our part) would have resulted in more specified data and conclusion.

AKR~

January 22, 2016- Hay Fusion Culture Observations

Description

We observed the ecosystem that is our Hay Culture Infusion.

Materials and Methods

Leaving the culture undisturbed, we made wet mounts of three different niches within our culture: One from the bottom, one from the middle, and one from the surface. We then each under a microscope.

Data

-Our Hay Infusion Culture has a natural and fresh smell to it; the smell is neither pungent, nor odorless.

-There is definitely a layer of some substance resting on the surface of the Hay Infusion Culture. It is unclear whether it is mold or some other structure.

-Organisms may differ close versus away from the plant matter due to their needs for survival. For example, if organisms need the plant matter as source for growth, then they will reside close to the plant. Organisms that do not rely on that will, conversely, not be obligated to reside in that specific area.

Image:rsz_1rsz_1rsz_2rsz_20160122_101328.jpg Image:rsz_1rsz_1rsz_20160122_101314.jpg


-Colpidium and euglena were found in our Hay Infusion Culture using the dichotomous key.

-Image:rsz_11rsz_20160128_142603.jpg

-Both the colpidium and the euglena are motile. Colpidium are protazoans while euglena are photosynthesizing protists.

-The colpidium observed from a sample taken from the bottom of the Hay Infusion Culture was 5 micrometers, the euglena observed from a sample taken from the middle of the culture was 45 micrometers, and the colpidium observed from a sample taken from the top of the culture was 3 micrometers.

-The euglena meets all needs of life: it obtains energy through photosynthesis or phagocytosis,and uses that energy. Euglena is a cell, it processes information, and it replicates. Also, like any other living organism, it evolves.


Conclusion

If the Hay Infusion Culture "grew" for another two months, I would expect that carrying capacity would be reached at some point. I believe that the population would continue to flourish though given that euglena can utilize both phagocytosis as well as feeding by phototrophy. Additionally, colpidium feeds on bacteria. It is for this reason that the presence of colpidium suggests poor water quality. Regardless of the definition of poor water quality, bacteria will form in our Hay Culture Infusion if left to grow for two additional months.


AKR~

January 15, 2016- Observations of a Transect

Description

We observed the biotic and abiotic components of a transect within the American University Campus. In addition, we collected material such as soil, weeds, leaves, and wood chips within our assigned transect in order to create a Hay Infusion Culture.


Materials and Methods

With a paper, pencil, and a clipboard, we used our observations to sketch an aerial view of our transect. While on location, we filled a plastic bag with both biotic and abiotic material. We also captured a few pictures for further reference.


Data

Image:20160115_092637.jpg Image:20160115_093035.jpg

Image:20160115_093045.jpg Image:20160115_092903.jpg

Image:20160115_092655.jpg


The following were biotic and abiotic components:


Biotic- Organisms in soil, weeds, tree, lettuce

Abiotic- Wood chips, wooden plots, metal structure, scarecrow


Image:rsz_1rsz_20160129_012501.jpg


Conclusions

Our transect was half of a little garden that saw abiotic materials contributing to the organized growth of biotic materials. Accordingly, there was soil, with a thick layer of wood chips resting on top. Within the gated garden, there were wooden structures filled with soil, meant to promote the growth of the produce inside. Since it is winter, though, only the lettuce remained to some extent. Within the wooden structures, there were plenty of weeds and dead plants. Along the sides of the transect (close to the gate surrounding the garden) there were weeds. We performed this lab in order to document the biodiversity that exists around us in our ecosystem. This is important in that studying this will make clear the relationship between organisms that share that specific niche as a home.


AKR~

Notes

  • Place some notes here for visitors
  • Example: This project is currently on hold until further notice.


Recent changes



Personal tools