User:Alexander S Mikheyev/Notebook/rotifer alien genes/2010/03/29

From OpenWetWare

Jump to: navigation, search
Alien genes Main project page
Previous entry      Next entry

Contents

Testing Lea primers

  • These were designed off A. ricciae sequence with the goal of amplifying all four copies of the gene

Lea primer sequences

Lea1F CGACAGTGCTACTTTCGTAAAAGAT
Lea1R ACAGCTGGTTTAATTGCATCC
Lea2F GAAGCTTCACTTGAAACAGCAG
Lea2R AATTCAGTAGCTTGTCGTTTCTTTT

Reaction conditions

Reaction mixture conc. 1x 4
water7.2529
TopTaq buffer10x14
dNTP mix10 mM each0.20.8
Primer mix5 uM each0.5
TopTaq (QIAGEN)5U/ul0.050.2
template20 ng/ul0.5-
8.5
  • 95C 3min (60C 1 min, 95C 5s)x35

Gel

Blank! Tried the reaction a second time, and it also did not work, for A. vaga or A. ricciae

HCO LCO Screening

Reaction mixture conc. 1x 50 '
Template Instagene?1
TopTaq buffer10x150
dNTP mix10 mM each0.210
Primer mix5 uM each0.525
TopTaq (QIAGEN)5U/ul0.052.5
Milli Q water7.25362.5
10 ul4509.0ul / RXN
*Control AV 1ng/ul
PCR cycle
94C3 min
94C10 sec
45-68C3 min
RAMP 0.5C/sec
x35
68C5 min
AMP Lane Template '
1Ithaca 1A6
2Ithaca 1B1
3Ithaca 1B3
4Ithaca 1B5
5Ithaca 1C1
6Ithaca 1D1
7Ithaca 1D3
8Ithaca 1D4
9Ithaca 1D6
10Ithaca 2A1
11Ithaca 2A2
12Ithaca 2A3
13Ithaca 2A4
14Ithaca 2A5
15Pennsylvania (PA)B4
16Tsukuba 1A4
17Tsukuba 1A6
18Tsukuba 1B2
19Tsukuba 1B4
20Tsukuba 1C1
21Tsukuba 1C6
22Tsukuba 3D2
23Tsukuba 3D3
24Tsukuba 3D4
25Woods Hole 1A6
26Woods Hole 1C2
27Woods Hole 1C3
28YokohamaB5
29BaltimoreA3
30BaltimoreA6
31E. WindsorD4
32HarvardA1
33Ithaca 2A6
34Pennsylvania (PA)D4
35Tsukuba 1B5
36YokohamaA2
37BaltimoreC1
38Ithaca 1A4
39Pennsylvania (PA)B6
40YokohamaB2
41YokohamaA4
42Ithaca 1C4
43Ithaca 1D5
44BaltimoreC5
45E. WindsorA2
46Pennsylvania (PA)B3
47Ithaca 1C3
48Positive Control AV


Load 1.0ul sample Image:30march10.jpg

Alien Gene LongPCR

Amplification of TEL_L_A : new primer screen

Reaction mixture conc. 1x 5
*Template 1ng/ul15
TopTaq buffer10x15
dNTP mix10 mM each0.21
Primer mix5 uM each1
TopTaq (QIAGEN)5U/ul0.050.25
Milli Q water6.7533.75
10 ul45
*CCA3 or AV9.0ul/RXN
PCR cycle
94C3 min
98C10 sec
60C3 min
x35
72C5 min
AMP Lane Template Contents
AAVAV10083
BAVAV10084.2
CAVAV10085
DAVAV10090
ECCA3AV10083
FCCA3AV10084.2
GCCA3AV10085
HCCA3AV10090

Evaporation in some wells - Re-Amp

Amplification of TEL_L_B

' [CONC] 1X 20 '
Water5.3106
Takara LA Taq5U0.12
Takara LA Buffer10X120
dNTP2.5uM each1.632
*Template1ng120
Primer Mix5uM each1
10.0ul1809.0ul/RXN
add 1.0 Primer Mix
* AV or CCA3
PCR Cycle
94C 1 min
98C10 sec
65C15 min
30X
AMP Lane Template MIX Contents ' Size Fosmid
1AVTEL_L_B_1TEL_L_B_1AV TEL L B
2AVTEL_L_B_2TEL_L_B_2AV TEL L B
3AVTEL_L_B_3TEL_L_B_3AV TEL L B
4AVTEL_L_B_4TEL_L_B_4AV TEL L B
5AV109AV10106 FWDAV10107 RVSAV TEL L B
6AV110AV10106 FWDAV10107.2 RVSAV TEL L B
7AV111AV10106 FWDAV10108.2 RVSAV TEL L B
8AV112AV10107.1 FWDAV10108 RVSAV TEL L B
9AV113AV10107.1 FWDAV10108.2 RVSAV TEL L B
10AV114AV10107.2 FWDAV10108 RVSAV TEL L B
11AV115AV10107.2 FWDAV10108.2 RVSAV TEL L B
12AV116AV10111 FWDAV10112 RVSAV TEL L B
13AV117AV10111 FWDAV10113 RVSAV TEL L B
14AV118AV10111.2 FWDAV10112 RVSAV TEL L B
15AV119AV10111.2 FWDAV10113 RVSAV TEL L B
16AV120AV10112 FWDAV114 RVSAV TEL L B
17AV121AV10113 FWDAV114 RVSAV TEL L B
18AV122AV108.2 FWDAV114 RVSAV TEL L B
19CCA3TEL_L_B_1TEL_L_B_1AV TEL L B
20CCA3TEL_L_B_2TEL_L_B_2AV TEL L B
21CCA3TEL_L_B_3TEL_L_B_3AV TEL L B
22CCA3TEL_L_B_4TEL_L_B_4AV TEL L B
23CCA3109AV10106 FWDAV10107 RVSAV TEL L B
24CCA3110AV10106 FWDAV10107.2 RVSAV TEL L B
25CCA3111AV10106 FWDAV10108.2 RVSAV TEL L B
26CCA3112AV10107.1 FWDAV10108 RVSAV TEL L B
27CCA3113AV10107.1 FWDAV10108.2 RVSAV TEL L B
28CCA3114AV10107.2 FWDAV10108 RVSAV TEL L B
29CCA3115AV10107.2 FWDAV10108.2 RVSAV TEL L B
30CCA3116AV10111 FWDAV10112 RVSAV TEL L B
31CCA3117AV10111 FWDAV10113 RVSAV TEL L B
32CCA3118AV10111.2 FWDAV10112 RVSAV TEL L B
33CCA3119AV10111.2 FWDAV10113 RVSAV TEL L B
34CCA3120AV10112 FWDAV114 RVSAV TEL L B
35CCA3121AV10113 FWDAV114 RVSAV TEL L B
36CCA3122AV108.2 FWDAV114 RVSAV TEL L B

Load 1.0ul sample Image:29march10 gel 1.jpg

Load 1.0ul sample Image:29march10 gel 2.jpg

Personal tools