User:Alison M. Mariano/Notebook/Biology 210 at AU

3/19/2015
Zebra Fish Lab: The Effects of Estrogen

Purpose: The purpose of this lab was to investigate the development of zebra fish embryos under certain conditions. Once placed under these certain conditions, the experimenter observed the effects on the zebra fish through the changes in development between the control and the experimental group as well as through the death count between the two. In this case, the experimental hormone estrogen was observed. The hypothesis that was tested was that the estrogen would physically change the zebra fish development stages, but would allow most of them to live in the experimental and control groups.

Materials
- 40 zebra fish embryos
- two petri dishes
- 20 mLs of Deerpark Water
- estrogen
- dissecting scope
- microscope
- paraformaldehyde

Methods
Day 1: On day one, two petri dishes were set up: one with 20 mLs f Deerpark water and the other with the experimental solution (in this case estrogen). 20 healthy and lively embryos were added to each of the two petri dishes. Both the dishes were left alone for the next couple days to grow and develop.

Day 4 and 5: On day 4 or 5, 10 mLs od water was removed from the control and an addition 25 mLs of water was added. The same was also done for the experimental group. This addition to both of the petri dishes was created as to account for the loss of solution due to evaporation. Also, any dead embryos (embryos that look moldy or dead) were removed from both the experimental and control so they do not contaminate other embryos. For observations that needed to be made, a depression slide was made in order to note any changes in the body.

Day 7: On day 7, 5mLs of solution was taken out of each petri dish and 10mLs were added. Day 7 was also the day that the Zebra fish would start receiving food in the form of paramecium. Also, three live embryos from each group were removed and placed in a separate test tube. With in each test tube, paraformaldehyde was applied so that the Zebra Fish can die a peaceful and graceful death and that the experimenters may easily observe them. Also, the fish were observed for any changes and the dead were separated from the living.

Day 14: On day 14, the final observations were made as well as a depression slide of the Zebra fish preserved in paraformaldehyde. The live fish were then taken from the petri dishes and placed in a safe environment were as the dead fish were disposed of.

Observation
Day 1: All the fish that were placed in each petri fish were alive. They were all slightly past the zygote stage, where a majority of yolk was present. However, eyes were visible under the dissecting scope.

Day 4: With in the estrogen- experimental group a total of three had died. In the control group a total of 6 embryos died. The dead embryos exhibited signs of the color yellow as well as looking moldy and fuzzy. The ones that were living displayed what was typically found in the somite stages. Much of the yolk was still present, and the tail was still curved underneath. There was not much of a difference between the development of the experimental and control group.

Day 5: No deaths were observed in either group on day 5 and no developmental changes were noted.

Day 7: With in the estrogen-experimental group a total of 15 were left and in the control group and a total of 12 were left. No developmental difference were apparent to the human eye through the use of the dissecting scope and microscope.

Day 14: All the control and experimental did not survive. However, large developmental differences were noticed from the preserved fish from day 7 in the paraformaldehyde. In the estrogen based solution, all the important organs of the organism was vastly enlarged. The eyes were twice the size, the heart was extremely large, and all the veins (black substance) looked enormous in comparison to the control.



Conclusion: In conclusion it can not be determined whether the estrogen played a role in the life span of the zebra fish, since both all of the control and experimental fish died. However, it can be determined that estrogen does play a vital role in developmental differences as seen from the preserved fish examined on day 14.
AM

March 5, 2015
DNA Sequencing for Transect 5
Purpose: The purpose of this lab was to take bacteria from a sample that was found among either the tetracycline or nutrient rich plates and discover their DNA sequence or organism species through the use of PCR. With the identification of bacterial organisms, a better understanding of the transect can be obtained.

Materials:
- bacteria
- water
- sterile tube
- tetrycacline rich and nutrient rich agar plates
- heat block
- centrifuge
- primer
- PCR tube
- PCR machine
- Agarose gel

Methods: In this lab section, bacteria from one of the chosen agar plates (does not matter which one) was transferred to a labeled sterile tube filled with 100μl of water. The next step was that it was incubated in heat block for 10 minute followed by being centrifuged for 5 minutes at 13,400 rpm. Throughout centrifugation, 20μl of primer was added to the test tube and mixed to dissolve the PCR bead. 5μl of the supernatant were transferred to the 16S PCR reaction and placed in the PCR machine. Once the PCR was completed, the product was run on an agarose gel to identify the DNA sequence. Two bacteria samples that produced noticeable DNA were sent to be sequenced.

Data and Observation
Sequences
NNNNNNNNNNGGNNNNNNNNNNNGCAGTCGAGCGGATGACGGGAGCTTGCTCCTTGATTCAGCGGCGGACGGGTGAGTAA TGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCA GGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGAC GATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGG GGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTA AGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCA GCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTG GATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTC CTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAN GTGCGAAAGCGTGGGGAGCAAACAGGATTANNATACCCTGGTAGTCCACGCCGTNNCGATGTCAACTAGCCNTTGGAATC CTTGAGATTTTAGTGGCGCANCTNACGCATTAAGTTGACCGCCTGGGGAGTACNNGCCGCAAGGTTAGANACTCNNTGAA TTGACNGGGCCCGCACAAGCGGTGGANCATGTGGTTTNAATTCNAANCAACNCNANACCTTACCNNGCCTTGACATGCNN ANNNCTTTCNNGANNTGGATTGGTGCCNNNNNNNNCTCTGACACANGTGCTGCATGGCTGTCNNNNNCTCGTGTCNNGAN ATNNTGGNNNNNTCNNNNTNNCNNNCNNNNNCCNNNN

Conclusion: The orgnaism found in this DNA sequence was Pseudomonas sp. YP19. This is very similar to the organisms that were identified in the agar plates. The identification of the species helps to further understand the type of transects that are found at American University.
AM

2/17/2015
Invertebrates on the American University Campus
Purpose: The purpose of this lab was to study and observe the invertebrates that were found in each particular transect; in this case transect number 5. The hypothesis that can be concluded is that based on previous knowledge of the transect, many of the invertebrates will fall into the class of insect.

Materials:
- funnel contraption
- petri dish
- microscope
- dissecting scope

Methods
Procedure I: Acoelomates, Pseudocoelomates, and Coelomates: In this procedure, the acoelomate, Planaria, was observed. It was observed by describing their movement as well as viewing a stained cross section.
Procedure II: Anthropods: In this procedure, the classes of anthropods were observed.
Procedure III: Analyzing the invertebrates collected with the Berlese Funnel: In this procedure, the funnel contraption was broken down so the invertebrates that fell into the ethanol could be observed. One the organisms in the ethanol were removed into two separate petri dishes, they were analyzed under the dissecting scope.

Observations and Data:


The size range of the organisms is between 1 and 6 millimeters. The organism that is the largest is the springtail x primative insect and the organism that is the smallest is the soil mite x. The proturan X primative insect is the most common .
Conclusion:
After examining the data table from above, it can be seen that they hypothesis was supported. Almost every single organism that was observed was of the insect class. This helps us to better under what kind of ecological community transect number 5 is; by observing what kind of arthropod was there and how many were found.
AM

2/17/2015
The Vertebrates and Niches of American University
Purpose: The purpose of this lab was to example the type of vertebrates that inhabit transect number 5. With this knowledge, a better understanding of what type of an ecological community can be compiled with the other data from this study and concluded.
Materials
- a pen
- a notebook
- the transect
- myself

Methods:
Procedure I: In this particular procedure, the experiment went to there transect and observed the vertebrates that were there.
Data and Observations:
Vertebrates:
- Squirrels
o Phylum: Chordata
o Class: Mammalia
o Order: Rodentia
o Family: Sciuridae
o Genus: Sciurus
o Species: Carolinensis
o What abiotic/biotic characteristics would benefit them: the bushes to cover them from becoming prey, the soft grass for their feet
- Humans
o Phylum: Chordata
o Class: Mammalia
o Order: Primates
o Family: Hominidae
o Genus: Homo
o Species: Sapiens
o What abiotic/biotic characteristics would benefit them: the characteristics that would benefit them is the benches; for it is a place to sit down
- Occasionally dogs
o Phylum: Chordata
o Class: Mammalia
o Order: Carnivora
o Family: Canidae
o Genus: Canis
o Species: Canis lupus
o What abiotic/biotic characteristics would benefit them: the grass, so they feel comfortable going to the bathroom
- Hummingbirds
o Phylum: Chordata
o Class:Aves
o Order: Apodiformes
o Family: Trochilidae
o Genus: Archilochus
o Species: Archilochus colubris
o What abiotic/biotic characteristics would benefit them: the bushes, where they can land and rest
- Cardinal
o Phylum: Chordata
o Class: Aves
o Order: Passerifomes
o Family: Cardinalidae
o Genus: Cardinalis
o Species: Cardinalis cardinalis
o What abiotic/biotic characteristics would benefit them: the bushes, where they can sit and rest

The community of the area consists of the biotic and abiotic characteristics that define the area. This includes the plants, fungi, bacteria, vertebrates, and invertebrates. In terms of the food web, the arthropods exist on the same trophic level as well as the bacteria. For the most part the only thing that exists outside of the same trophic level but falls into the same phylum. For the carrying capacity, this transect does not not exceed it. The transect can be defined as the niche’s ability to survive with all the organisms in it without depleting its energy source. This transect excels at that.
Conclusion: This section of the lab let us identify what vertebrates were present in the area, which in turn helped us to better identify what type of overall ecosystem is present in this transect.
AM

February 12, 2015
Plantae and Fungi
Purpose: The purpose of this lab was to observe plants a found in our own transects and analyze them for three general features:
1. vascularization
2. specialized structures
3. reproduction methods
Fungi were also observed during this lab or features such as how they obtain the nutrients they need from food
Materials
- 3 zip lock bags
- plants from the transect
- lily
- moss
- microscope
- slides and cover slips
- ethanol
- screening material
- tape
- leaf litter watt lamp with incandescent light bulbs
- funnel
Methods
Procedure I: Collecting five plant samples from the transect: Three Ziploc bags taken from the laboratory. One bag was used from leaf litter, another bag was used to collect five samples from the area that would not disturb the area, and the last bag was used to collect seeds, flowers, or pine cones. These were all brought back to the lab.
Procedure III Plant Vascularization: In this particular section of the lab, the moss was compared to the stem of the lily for observation on vascularization systems. Well observing the moss and lily under a microscope through a cross section, the xylem and phloem were identified. This same procedure was use to identify the types of vascularization systems in the plants from our own transect.
Procedure III: Presence of Specialized Structures: In this procedure, the shape, size, and arrangement of the leaves from each plant were under observation. Specialized cells such as stomata, guard cells, and mesophyll cells were looked for.
Procedure IV: Mechanisms of Plant Reproduction: The seeds from one of the Ziploc bags were observed. They were either identified as monocot or dicot and it was recorded if there was any evidence of flowers or spores.
Procedure V: Observing Fungi: The experimenter had to determine if any fungi was found in the area. If it was identified, the fungi would have to be categorized into the groups of zygomucota, basidiomycota, or Ascomycota.
Procedure VI: Setting up the Berlese Funnel to Collect Invertebrates: In order to collect invertebrates, 25 mL of the 50:50 ethanol/water solution was put into a conical tube. Screening material was placed into the opening of a funnel so that leaf litter would not fall into the ethanol. The conical tube was attached to the funnel, leave litter was placed in the top, and the funnel was then attached to a ring stand. The ring stand was placed under incandescent light bulbs for one week.

Observations
Unfortunately, there were no fungi present in the sample. Also, picture of the plants could not be uploaded due to technical difficulties. Conclusions:
Out of the five plants that were collected and observe (tree, bush, grass, weed, and clover) they all had similar and different characteristics. For example, all of the plants had vascularization system that included a xylem and phloem. Each organism was inspected to see whether it was a monocot and dicot. Also, there overall appearance was measured: whether the plant was tall, leafy, thorny, or even the color. The categorization of these plants helped us to better understand the type of ecosystem our transect is a part of. As the weeks progress, and more information is revealed about the transect (in this case the plants and fungi) the better predictions can be bad about what type of environment it is.
AM

2/5/2015
Characterizing and Observing the Growth of Bacteria in Antibiotic Plates
Purpose: The purpose behind this particular lab was to observe and identify the development of bacteria that were injected onto the agar plates from the Hay Infusion Culture. Also, the objectives behind this lab were to understand how bacteria respond to antibiotics such as tetracycline. Wet mounts and gram stains were created to further comprehend the type or organisms that were found in these agar plates. The hypothesis for this lab was that since the samples were taken near a grassy surface with mulch, the bacteria would be very resistance near the final serial dilution.

Materials
- Hay Infusion Culture
- Agar nutrient plates
- Agar nutrient plates with tetracycline
- A pencil/pen
- Lab Manuel
- Microscope
- Sterilized loop
- Bunsen burner
- Water
- Slide
- Cover slip
- Crystal violet dye
- Iodine
- Alcohol
- Safranin stain
- Kimwipe
- Oil
- Heat block
- Centrifuge
- PCR tubes
- Micropipetter
- PCR machine
Methods
Pre-procedures: Before starting the lab, one last observation about the Hay Infusion Culture was made. A change in smell or appearance was made as well as a hypothesis as to why this change occurred.

Procedure I: Quantifying and Observing Microorganism: Once the agar nutrient plates and the nutrient plates with tetracycline were brought over to the lab table an observation of them were made. The total numbers of colonies on each plate were counted and they were then converted to colonies per mL.

Procedure II: Antibiotic Resistance: Procedure II consisted of more observations about the plates. Questions such as “ is there any difference between the plates with the antibiotics versus the plates without” or “ what was the overall effect of the tetracycline?” Also, research on the affects of tetracycline was done.

Procedure III: Bacteria Cell Morphology Observations: In this section of the lab, four samples were taken; two from a nutrient agar plate of choosing and two from a nutrient plate with tetracycline of the experimenters choosing. For each sample that was taken both a wet mount and gram stain were made. From these samples a table of colony description, cell description, and gram positivity or negativity.
To make a wet mount: The first thing that occurred was that a loop was sterilized by the use of a Bunsen burner. The loop was then used to take a tiny sample form one of the nutrient plates. The sample was placed on the slide with a drop of water. A cover slip was placed on top of the sample, where it was then placed under the microscope. This was done for all four samples.
To make a gram stain: A loop was yet again sterilized and a scrap was placed on a slide with the use of the sterilized loop. On the underside of the slide, a circle was made with a red wax pencil to indicate where the sample was. Next, the slide was waved through a flame three times so that the sample could dry. The bacterial sample was then covered with crystal violet for one minute. After the one-minute mark had passed, the crystal violet was cleared off with water. The same process was then done for iodine. Alcohol was then added for 20-30 seconds. The same process was then done with safranin. A kimwipe was then used to wipe away any excess dye on the slide. Once the slide was dry, it was placed under the microscope for observations. This was done for all 4 samples.

Procedure IV: From each of the four samples, a PCR was made. The PCR was made by taking a colony from a sample and adding it to a test tube filled with 100μl of water. The sample was then incubated at 100oC for 10 minutes. After being heated, the samples were placed in the centrifuge for 5 minutes at 13,400rpm. 20μl of primer (water) was added to the PCR tube as to dissolve the PCR bead during centrifugation. The last step consisted of taking 5μl of supernatant and placing it in the 16s PCR reaction.

Data and Observations
Pre-procedure: The observation from the Hay Infusion Culture consisted of…
- not smelling as bad as the week before
- darker and less water due to evaporation→ you can actually see the line where the water use to be
- there were more leaves settled as the bottom
- there was no color change in the plants
Procedure I:

Procedure II: The difference between the colony types on the plate with the nutrient versus the nutrient with tetracycline was that the antibiotic created drastically less colonies. Tetracycline has three different mechanisms: tetracycline efflux, ribosome protection and tetracycline modification. Tetracycline restrains bacteria that are both gram-positive and gram-negative from growing. These organisms include chlamydiae, parasties, and many more(Speer, Salyers, and Shoemaker, 1992).
Procedure III:

Conclusion: This lab help to identify how resistant the bacteria was to tetracycline. In turn, this would help us to better understand the ecosystem by comprehending the type or organisms that live there. Also, the hypothesis was supported. By looking at the plates, it is clear that the bacteria were resistant by the end of the serial dilution.

References Speer, B., Salyers, A., & Shoemaker, N. (1992). Bacterial resistance to tetracycline: Mechanisms, transfer, and clinical significance. American Society for MIcrobiology, 5(4), 387-399.

AM

1/28/2015
Observing and Identifying Organisms With the Use of a Dichotomous Key
Purpose
The purpose behind this lab was to understand how to use a dichotomous key and be able to apply it to living organisms found in our assigned transect. The importance of identifying organisms with the help of the dichotomous key from the Hay Infusion Culture is to better understand the ecosystem that is American University. By understanding the organisms of an environment, scientists can better comprehend what other organisms would thrive there. Also, another purpose of the lab was to prepare for the following lab by creating serial dilutions from the Hay Infusion Culture. A hypothesis that could be created from this experiment is that if organisms were identified from the Hay Infusion Culture, then it could help better understand the environment which it came from.
Materials
The materials use in this lab were…
- a microscope
- dichotomous key
- already known organisms
- Hay Infusion Culture
- Notebook
- Pen
- Lab Manuel
- micropippetor
- Four nutrient agar plates
- Four nutrient agar plates with tetracycline
- A sharpie
Methods
Procedure 1: The first procedure of this lab included learning how to use the dichotomous key. To start learning how to use the dichotomous key, wet mounts of known organisms were made. They were viewed under the microscope with the objective lenses of 4X and 10X, rather than 40X because many organisms were moving too fast to be seen under this lens. Then, the dichotomous key was used to determine the identity of the organism by following the questions on the key.

Procedure 2: The second procedure consisted of using the Hay Infusion Culture to identity organisms from the assigned transect. The Hay Infusion Culture was brought over to the lab station and inspected for smell and appearance. After an initial observation was made, samples were taken from two different niches in the culture. From these two different niches, wet mounts were made to identify some of the algae and protists with a dichotomous key. Three organisms were identified from each sample.

Procedure 3: After procedure 2 was completed, preparations for the next lab were made. These preparations were made by the creation of nutrient agar petri dishes. Four test tubes were labeled 10-2 , 10-4 , 10-6, and 10-8. Next, all the plates with tetracycline were labeled “tet,” as well as labeled 10-3, 10-5,10-7, and 10-9. The Hay Infusion Culture was then stirred to mix up the organisms. 100μL was added to 10mLs of broth in the test tube of the 10-2 test tube. Then 100μL was taken from the 10-2 test tube and placed in the 10-4 test tube. This continued until the 10-8 test tube was filled. To put the serial dilution on the plates, 100μL were pipetted from the 10-2 onto the 10-3 plates (both the nutrient agar plate and tetracycline). This continued for the 10-5,10-7, and 10-9 plates; the 10-5 was filled with the 10-4, 10-7 was filled with 10-6, and 10-9 was filled with 10-8. The plates were then incubated at room temperature.

Data & Observations

Smell of the container: horrible, garbage-like, not rotten egg like)

Visual Observation:
Top of the jar → grass, clumps of dirt, surface almost looks impenetrable (like when you crack ice), some green grass poking through the top.
Middle of Jar → nothing really floating there
Bottom of Jar → grass, sediment of dirt sunk on the bottom, darker colored water towards the bottom.

Sample 1→ taken from the top of the jar in the center
Some of the type of organisms found in this sample were colpidium (55μm), Paramecium Aurelia (120μm), and a round, squished organism that could not be identified with the dichotomous key.

Sample 2→ taken near plant life at the bottom
Some of the type of organisms found in this sample were colpidium (50μm), a tiny single celled organism that was identified as chlamydamonas (6μm), and Gonium (20μm).

Conclusion
Since Colpidium was found in both samples taken (the one taken near the top of the jar and the bottom of the jar) it can be assumed that this transect retains a lot of water since colpidum is mainly found near water sources. Since there were no streams or lakes near this environment, the recent weather of snow and rain could have impacted it. From this lab the hypothesis was supported; a better understand of the environment could have been concluded by discovering the types of organisms in the transect.
AM

1/25/2015 Observing a Niche at AU
Purpose: The purpose of this lab was to observe a 20 by 20 meter area of land on the American University campus that was defined by four popsicle sticks. Five groups were created and assigned to five different areas throughout American University. These observations that were made included general characteristics such as topography, location in regards to the campus, and biotic and abiotic features. Once these notes where taken, a Hay Infusion Culture was created for use in the next lab in order to observe protist and bacteria life from the transect. My group was assigned to transect number 5, which can be found on the main quad near the Eric A. Friedheim Quadrangle benches. Inside this transect was a grass area that included mulch, bushes, and some stone structures such as tiles, benches, and a wall. After observing the environment, I hypothesized that this area would lack wildlife since it is heavily populated by students as well as making the assumption that since it is well maintained by American University staff members it will constantly look very manicured.
Materials
- transect 5 (Eric A. Friedheim Quadrangle benches)
- a notebook
- a pencil/pen