User:Ana Matos/Notebook/Aulas de BioMolecular/2010/03/16

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Aula 3

Sequenciação de DNA

Introdução As sequências de genes e mRNAs com que temos vindo a trabalhar foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing

Note que o resultado de uma sequenciação é um electroferograma, que depois é convertido em "As, Cs, Gs e Ts" por um programa informático.



Questões

O que é necessário para fazer uma reacção de sequenciação? Para uma reacção de sequênciação ser bem sucedida é necessário o fragmento de DNA a analisar, nucleótidos como peças do novo DNA, dNTP, primer para a iniciação da replicação, DNA polimerase e os didNTP, os nucleótidos terminadores.

Que cadeia é sequenciada? A cadeia do primer, que é complementar do DNA molde.

Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação? Porque os didNTP quando se ligam à cadeia a sequenciar terminam a replicação.

Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo? Porque adicionamos ao tubo muito mais quantidade de dNTP's do que didNTP's para que a adição de nucleótidos dos 2 tipos seja aleatória e não comece sempre por ser adicionado um didNTP.


Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem? Existe sobreposição de picos nas duas extremidades, isto porque na electroforese é dificil distinguir nucleótidos muito parecidos em número (vão "sair" ao mesmo tempo). No inicio vão ser fragmentos muito pequenos e no fim muito grandes.

O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo? Posso "partir" (ou seja, começar uma nova sequência com um primer no local que quero) o segmento em fragmentos de 600-1000 nucleótidos, tendo em conta em alargar sempre os fragmentos com um pouco do anterior para ter em conta a sobreposição das extremidades na electroforese.


Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo? Usando o código A-verde;C-azul;G-preto;T-vermelho temos:

1-TCGTGTTCTATGATCATGAGAGTCGCCG

2-TCGTGTTCTATGATGATGAGAGTCGCCG e TCGTGTTCTATGATCATGAGAGTCGCCG, logo é heterozigotico, o pico do C e G estão sobrepostos.


Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder? Com o conhecimento prévio da sequência do gene posso ter um primer especifico que se liga ao gene da beta globina. A técnica de sequênciação só é utilizada em DNA logo teriamos que usar uma transcriptase reversa para converter o RNA em DNA.

Considere os resultados da sequenciação discutida no Caso de Estudo 1.

1.Que aspecto esperaria encontrar no electroferograma na região variável de cada indivíduo? 2.Se tivesse apenas acesso aos resultados da sequenciação da Maria, seria capaz de definir o seu genótipo com rigor? Justifique. Com base na sequência do gene da beta-globina disponível na última TP e as técnicas de análise de sequências que tem vindo a aprender identifique as regiões do gene em que se localizam as alterações pontuais encontradas.


Para pensar Se a sequenciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações?


Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano?


Personal tools