User:Audrey Denkler/Notebook/Biology 210 at AU

Zebrafish Experiment Update 3/4/16

At this point in our zebrafish experiment there was one living fish left in the ethanol concentration, and five left in the control. The one left in the ethanol was preserved along with two from the control. The size of the one living ethanol fish was 33. The living controls in A3, B3, and D3 were sized at 29, 20, and 22. Pictures of the preserved fish still need to be taken so there are no pictures at the moment for this time of the lab. But the chart of the documentation of the fish over the course of the past 2 weeks can be seen at: audreydenklerbiology210.tumblr.com .

Zebrafish Experiment & PCR- 2/26/16 PCR Sequence: GCCNNNNGGTACCGNNGGTAGCGTNNTATATTGCTCTCNNTGATGANTGGGNNNNNNNNNNN GGTGGCTGGGAAGCTGCCGGATGGNAGGGGATAACTACTGGAAACGGTATCTAATACCCCAAAACGTCGCAATACCGTCA GGGGCACCTTCAGGCCTCTTGCCATGGNATGTGCCCAGATGGGATTAGCTAGTANGTGGGGTAATGGCTCACCTANGCGA CNATACCNAGCTGGTCTGAGAGGATGACCACCCACACTGGAACTGAGACACGGTCCACACTCCTACGGGAGGCAGCAGGG GGGAATATTNCTGNATGGGCGCCGGCCTGATGCGNCCATGCCGCGTGTATGAAGAACGCCTTCNGGTTGTAAACTACTTT CAACGAAGAGGAAGGCATTGAGGTTAATAACCGNNNGGATTGACTTTACTCGCANAGCAAACACCGGCNGAAATCCNTGG CGTCNNCCNCGNTAATAGNNGANNGGCAAGCGATTAATCGNANTTGCTAGGGCCTATAGCACATGNNNGNNGNCTGTCGG NGCGGAACTGAAATCCCCCGGCTCANCCNGAGTAACTTCNTTCAAGACTGGAGTTCTGTAGTCCTGTAAAGGGGGNATAN AAGTCCNGATGAAAGGGTNAAATGCNTCNAAGGCTANNNATGCCATNNNGTGAAACGCCTNCCCANCAGAANACTAGNAC TCAGGTANGNGGGGTGAANAGGATGAANGTATTCNNNNNNTCCTTACTCCATCCCGNNGNNNNANNTCNATNTGNGANTT NGNGCNCCAGAGAGACAAACNNNNNGANNNANNANTTANCTNCGCCGGCCNGGNNNGNAGNNGGNNANNANTACNAANNN GACGGANNGCNCGCNNGCCNGGNNGNNNAGNNNATCTTGTTCTTNTGAGTNCNTG

Image at: audreydenklerbiology210.tumblr.com

The Lelliottia amnigena bacteria is the sequence that matched closest to our bacteria. The colony morphology is very similar to the one seen in our agar plates, very small centralized and compact bacterial colonies.

Zebrafish: Our fish have been fed on 2/24, 2/26, and 2/30. When they were checked on the 2/29/2016 there were five zebra fish still alive in the ethanol concentration. Their sizes were about 53, 60, 45, and 54. There were 15 zebrafish still alive in the control. Their sizes were about 50, 42, 39, and 43. The chart tracking their progress can be seen at the link: audreydenklerbiology210.tumblr.com.

Zebrafish Exposure- 2/19/16 In this experiment the effect of an ethanol (1% concentration) on the development of Zebrafish growth is being studied. The control is the Zebrafish in the regular anti-fungal water. The size of the Zebrafishes eyes and body size is being measured. Hypothesized is that the Zebrafish developing in the ethanol dilution will have greater eye diameters, show less or more distortions in development, and higher mortality rates. To set up this experiment 2-3 mL of Deerpark water containing treatment was placed in 20 of the wells of the culture tray. In the second culture tray 2-3 mL of the 1% ethanol dilution was placed in 20 of the wells. After both trays were filled with their perspective dilutions a healthy transparent Zebrafish embryo was placed in each well. The eggs were then left for a week at room temperature and checked every two days to monitor any changes and to feed the Zebrafish.

Vertebrates- 2/13/16 When setting up the Bernese Funnel, one of the smaller funnels was used. Then as much of the materials that could be put in the funnel was put into the funnel and filtered using a piece of net-like plastic. The funnel was then attached to an conical tube filled with 25mL of 50% ethanol/water to preserve whatever fell into the conical tube from the transect material collected. Parafilm was used to attach the conical tube to the funnel to prevent the ethanol from evaporating. It was then left under a 40 watt lamp for a week before the results were collected. The Invertebrate description chart, and pictures of the invertebrates spotted can be seen at this link: audreydenklerbiology210.tumblr.com .

Plants and Fungi- 2/5/16 Three of plant samples collected from transect 5 were found within the vegetable bins in our transect, and the other three were found on the ground growing out through the wood chips. Plant one was a bigger green leaf with rough round edges. It had net-like veins throughout and was found within one of the planters in our transect. The second plant was long and skinny. It had small straight pine-like leaves growing off with one singular vein growing through the leaves. This plant was found on the ground in our transect along the fence. The third plant was found on the ground growing through the wood chips in our transect, and had small leaves with wavy cut leaves and a small web-like vascular system. The fourth plant that was found was found growing out of the ground through the wood chips it had very large leaves with very dramatic wavy cuts and a very short small stem. The last plant was found in the planter in our transect and had very small round leaves with a waxy sort of coating on the leaves. Eat stock grows many little leaves with a regular sized stem. The pictures of these plants along with the plant characterization table can be found at this link: audreydenklerbiology210.tumblr.com .

Microbiology Lab- 1/29/16 To gram stain the slides, colonies from a 10^-3 and 10^-7 with and without tetracycline were taken and gram stained. To do this, tiny amounts of the bacterial colonies were scooped using a sterile inoculating loop and mixed into a drop of water on a slide. The slide was then heat fixed the slides by passing them over the flame three times bacteria side up. Then working on the staining tray the slide was covered with crystal violet for one minute, and then rinsed off with water. Next the bacterial smear was covered with Gram's iodine mordant for one minute, and then rinsed off with water. The slide was then decolorized by being flooded with 95% alcohol for 10-20 seconds. It was then gently rinsed. The slide was then covered with a safranin stain for 20-30 seconds, and then rinsed again with water. Next the excess water was blotted off the slide and allowed to air dry. This was repeated for all four variations of our chosen colonies and then examined under a microscope. Those results can be seen in the images at this link: audreydenklerbiology210.tumblr.com .

To perform PCR for 16s amplification two PCR tubes were labeled in detail of their contents and group identification. Then 20 µl of a primer/water mixture was added into the labeled PCR tubes. It was then mixed to dissolve the PCR bead. With a sterile toothpick, a small amount of the 10^-3 with and with tetracycline on separate toothpicks was scooped and mixed into their respective labeled PCR tubes. The tubes were then capped and placed in the PCR machine.

Serial Dilution Results Table and Bacteria Characterization Table can also be see at this link: audreydenklerbiology210.tumblr.com .