User:Daniel Ramirez/Notebook/UNAM Genomics Mexico 2011/2011/08/08

From OpenWetWare

Jump to: navigation, search
UNAM Genomics Mexico 2011 Main project page
Previous entry      Next entry

χρόνος πέρασμα August 8th 2011

HydA CAI Optimization Control

ABSTRACT
  • Design of the primers for the amplification of the optimized and wild-type HydA.

  • Today I designed the primers that will be needed to amplify the CDS of the optimized and wild-type HydA genes.

HYDA WILD-TYPE NON OPTIMIZED

NheI site - HydA 5' end first 25 nt (34 nt) Tm = 60°C CTAGCTAGCATGAAAACAATAATCTTAAATGGCA

HydA 3' end last 20 nt - Double Stop Codon - Suffix (61 nt) AAAATGTTTCAAAACATGAATAATAATACTAGTAGCGGCCGCTGCAGAACCAATGCATTGG

HydA 3' end last 20 nt - Double Stop Codon - Suffix - reverse complement (61 nt) Tm = 71°C CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATTATTATTCATGTTTTGAAACATTTT


HYDA OPTIMIZED

NheI site - HydA 5' end first 25 nt (34 nt) Tm = 67°C CTAGCTAGCATGAAGACCATCATCCTGAACGGCA

HydA 3' end last 20 nt - Double Stop Codon - Suffix (61 nt) AGAACGTCTCGAAGCATGAGTAATAATACTAGTAGCGGCCGCTGCAGAACCAATGCATTGG

HydA 3' end last 20 nt - Double Stop Codon - Suffix - reverse complement (61 nt) Tm = 74°C CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATTATTACTCATGCTTCGAGACGTTCT


  • The amplified region should be flanked with the necessary restriction sites that allows us to ligate them with the constitutive promoter J04500 [1] (actually is a IPTG inducible promoter, but according our advisors and other researchers, it acts as a constitutive promoter in Rhizobium etli) and later on, ligated with the transcriptional terminator B0015 [2].


Personal tools