User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/10/27

From OpenWetWare

Jump to: navigation, search
Cell Fate Switch by Synthetic Transcription Factors Main project page
Previous entry      Next entry

New Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
INS1 NM_008386.3 cagagaggaggtactttggactataaa gccatgttgaaacaatgacct 105, cat.no. 04692241001
NKX6-1 NM_144955.2 cccggagtgatgcagagt gaacgtgggtctggtgtgtt 103, cat.no. 04692217001
MNX1 NM_019944.2 gatgccggacttcagctc agctgctggctggtgaag 60, cat.no. 04688589001
SLC30A8 NM_172816.3 gctgcttcagcaatatgcttc cagactcccagcaacgtgt 53, cat.no. 04688503001
KLF9 NM_010638.4 ctcagaactgcttttaacattaggg aacactttcctttttagctcgtg 32, cat.no. 04687655001
PCSK2 NM_008792.4 ggcgtgtttgcattagcttt gcacagtcagatgttgcatgt 85, cat.no. 04689097001

OTHER: Plasmid Verification of PcTFs

Restriction Digest Table

  • Checked plasmid minipreps with EcoRI/PstI digests
Reagent Volume Expected:
1. hPCD = 1921 bp, 4592 bp
Today's gel
15 μL/lane; 1% agarose; Ladder
DNA(plasmid) 5.0 μL
10X FD Buffer 1.5
EcoRI 1.0
PstI 1.0
dH2O 6.5
  15 μL --> 37°C/ 15 min.

Conclusion All bands at ~4900 and ~2000; indicating MV2 vector and PcTF insert, respectively.



Personal tools