User:Diogo Amaral/Notebook/Caderno BioMol/2010/03/16

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry


  • O que é necessário para fazer uma reacção de sequenciação?
 Cadeia de ADN molde, um sequência primer, a enzima ADN polimerase, nucleótidos livres e os quatro dNTPS.
  • Que cadeia é sequenciada?
 É uma cadeia complementar do molde de ADN que é sintetizada de 5' para 3', a partir do primer.
  • Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação?
 Porque usa bases "desoxi" quimicamente alteradas para terminar as sequencias sintetizadas numa base especifica.
  • Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo?
 Porque só os nucleotdios desoxidados é que não tem um grupo OH no carbono 3' da sua pentose, o que causa o termiino da sequenciação.
  • Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?
 Hà um bolha de tinta entre a posição 420 e 430. Sequencia longa de Cs e Gs que podem formar estruturas plas quais o ADN polimerase não consegue passar e por isso ha uma paragem subita do sinal da sequencia de ADN
  • O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?
  Realizando várias reacções de sequenciaçao com primers diferentes. 
  • Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?

1 - agcacaagatactagtactctcagcggc 2 - agcacaagatactactactctcagcggc

  • Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder?

Realizaria um cycling sequencing. O primer complementar pode ser obtido através da reacção de degradação de de Edman ou espectrometria de massa.

  • Considere os resultados da sequenciação discutida no Caso de Estudo 1.
  1. Que aspecto esperaria encontrar no electroferograma na região variável de cada indivíduo?
     Mãe: na posição 462 esperaria encontrar um pico vermelho, onde deveria estar um verde
     Pai: na posição 732 esperaria encontrar um pico vermelho onde deveria estar um azul
  2. Se tivesse apenas acesso aos resultados da sequenciação da Maria, seria capaz de definir o seu genótipo com rigor? Justifique. 
     Não, pois apenas uma das cadeias serve de molde para a sequenciação.
  • Com base na sequência do gene da beta-globina disponível na última TP e as técnicas de análise de sequências que tem vindo a aprender identifique as regiões do gene em que se localizam as alterações pontuais encontradas.

Personal tools