User:Esther Lee/Notebook/DNA Sequencing/Entry Base

From OpenWetWare

Jump to: navigation, search
Project name Main project page

DNA SEQUENCING

Objective: To identify through DNA sequencing, the microorganism in found in the transects.

Result of gel electrophoresis

Image:OOW 10.jpg


We were not able to get valid results for DNA sequencing for our transect. However, we were able to observe Transect 3: Tall Grass because of the similarities of two transects. The DNA Sequence was: AAGATTAATACCCCATAATATTTTAAGTGGCATCACTTGAAATNGAAAACTCCGGTGGATAAAGATGGGCACGCTCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGATCTTTAGGG GGCCTGANAGGGTGATCCCCCACACTGGTACTGAGACACGGACCANACTCCTACGGTAGGATCAGTGAGGAATATT

Using NCBI BLAST, we identified the specie as Chryseobacterium and can be assumed that this particular bacteria is found in both tall grass and wildlife transects.



Personal tools