User:Filipa Ribeiro C. Lucas/Notebook/Filipa Lucas/2010/03/23

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Questões

Que características deve ter um primer de PCR?

A Reacção em Cadeia da Polimerase (PCR) é uma técnica de Biologia Molecular que permite replicação in vitro do DNA de forma extremamente rápida. Um primer de PCR marca as extremidades da sequencia alvo. São curtas sequências sintéticas, oligonucleótidos, entre 10 a 16 pares de bases (ou seja, tem que existir especificidade, tem que haver garantia que só se agarra à sequência alvo e o custo de produzir primers é outro ponto negativo para a utilização de primer com mais de 16pb). Além disso, outro ponto a considerar é a composição em nucleotidos - bases g e c ,que têm três ponto de hidrogénio, do ponto de vista de estabilidade térmica são mais usados. Por outro lado, São incluídos dois primers, para cada cadeia simples de dna que foi produzida durante o passo da desnaturação. Os primes deverão marcar o início da sequência alvo de DNA e têm que hibridar com a sequência complementar e não com ele prórprio. Baixa concentração: induz má polimerização. Elevada concentração: induz o aparecimento de produtosinespecíficos e formação de dímeros de primers.


Como qualquer DNA polimerase, a transcriptase reversa requer um primer iniciador, que pode ser de 3 tipos distintos: específico de gene, oligo-dT ou random (uma mistura aleatória de 6 a 8 nucleótidos). Em que situações pode ser utilizado cada um destes primers e que vantagens/desvantagens relativas apresentam?

Primer específico de gene: Primer complementar à sequência específica do gene em estudo. Estudo focado apenas no gene específico, apenas esta sequência vai passar e dar origem ao novo DNA, e assim não vai passar "ruído de fundo", ou seja, sequências que não interessam para o estudo em questão.

Primer oligo-dT: Primer constituído por multiplas desoxitimidinas que hibrida com as adeninas da cauda poli-adenilada presente na região 3' dos RNAm. Isolamento de RNAm Poli A.trascriptase reversa vai formar DNA de todas as moléculas de RNA multiplos (que contém a cauda de Poli A). Porém, há uma limitacao espacial, a transcriptase tem que ter em conta toda a sequência de RNAm, dado que a cauda de Poli A se localiza no final de sequência.

Primer random: Primer que pode ser efectuado por pools de oligonucleótidos de sequência variada que irão hibridar em toda a extensão de RNAm. Isolamento de RNA total. Mistura de primer aleatórios com vários tipos de sequência. Assim, vão ser produzidas várias moleculas de DNA que origina todos os tipos de fragmentos possíveis, a partir de RNA que contém e não contém a cauda de Poli A. Se a sequência for constituída por milhares pb, poderá obter-se as sequências finais. Porém, vão originar vários fragmentos e com vários tamanhos.


Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo.

O PCR é um procedimento experimental que permitirá identificar as mutações presentes no gene da beta-globulina. Por isso, não é necessário realizar RT-PCR nem termos acesso ao RNA. Assim, procede-se à localização de primers que levem à síntese do gene pela polimerase (transcripto específico-primer do gene específico), posteriormente, amplifica-se o DNA e sequencia-se.

Assim: 1. Design do par de primers que permitam a síntese da região do gene que é transcrita por PCR:

 a.	LEFT primer: CATATTCTGGAGACGCAGGA
 b.	RIGHT primer: TGCTCAAGGCCCTTCATAAT

2. Recolha da amostra biológica - esfregaço de células da mucosa bucal 3. Hidrólise ácida das células para obtenção do DNA 4. Preparar mix para PCR:

 a.	Amostra de DNA
 b.	2 primers
 c.	Taq polimerase
 d.	dNTPs
 e.	Solução tampão
 f.	Água

5. Realizar PCR e fazer uma electroforese 6. Purificação do DNA, obtido no PCR, para eliminar as sequências correspondentes aos primers 7. Design dos primers que permitam a sequenciação da região do gene que contém as mutações:

 a.	CATATTCTGGAGACGCAGGA (5’ → 3’)
 b.	TGTACACATATTGACCAAATCAGG (5’ → 3’)
 c.	ATGGGACGCTTGATGTTTTC (5’ → 3’)
 d.	GGCATAAAAGTCAGGGCAGA (5’ → 3’)

8. Preparar mix para sequenciação:

 a.	DNA template
 b.	Primers
 c.	DNA polimerase
 d.	dNTP (A, T, C e G)
 e.	ddNTP

Comparar os resultados da sequenciação com a sequência de referência (BLAST)


Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.

Para que seja possivel estudar a expressão do gene é necessário recorrer-se à técnica de RT-PCR. A partir do mRNA presente em cada membro da família em estudo e através da transcriptase reversa, obtém-se cDNA. O cDNA é estudado quantitativamente e qualitativamente, comparando-se sequências sem mutação com as sequências obtidas. Assim, deverá ter-se em conta os seguintes aspectos:

-Amostra biológica:

-Reagentes:

-Primers: Utilizar dois primer que cobram a região de interesse (totalidade do gene); O 2º primer deverá ser complementar ao final da sequência na direcção de 3'-5'.

CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG

-Produto obtido:

-Montagem da reacção: - Fazer o protocolo que indica o volume total usado e a quantidade a ser usada: de tampão, de dNTPs, dos dois primers, da sequência de DNA a ser amplificada, de DNA polimerase e àgua.

Protocolo:

1. Design dos primers para a reacção de RT:

 b.	RIGHT primer: CTTTCTTGCCATGAGCCTTC

2. Recolha da amostra biológica - sangue 3. Lise dos eritrócitos para obtenção do RNA (e sua preparação) 4. Preparar mix para reacção de RT:

 a.	RNA desnaturado
 b.	Solução tampão
 c.	dNTPs
 d.	MgCl2
 e.	Primers
 f.	Transcriptase reversa
 g.	Água

5. Design dos primers para a reacção de PCR:

 a.	LEFT primer: TCTGTCCACTCCTGATGCTG
 b.	RIGHT primer: CTTTCTTGCCATGAGCCTTC

6. Preparar mix para PCR:

 a.	cDNA
 b.	Solução tampão
 c.	Taq polimerase
 d.	2 primers
 e.	dNTPs
 f.	Água

7. Realizar PCR e fazer uma electroforese

-Resultados:

Personal tools