User:Gabriela Santos/Notebook/GabrielaSantos BIOMOL/2010/04/27

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Entry title

  • Digestão de DNA com enzimas de restrição

As enzimas de restrição são o bisturi dos biologistas moleculares pois permitem “cortar” o DNA de um modo preciso e reprodutível.

As enzimas de restrição fazem parte do grupo das nucleases, enzimas que clivam ligações fosfodiester entre nucleótidos adjacentes. As enzimas de restrição usadas em biologia molecular têm a grande vantagem de clivarem apenas as ligações entre nucleótidos com uma sequência específica. Existem comercializadas perto de 100 enzimas de restrição, cada uma das quais reconhece e cliva uma sequência única de nucleótidos.

As enzimas de restrição identificam-se por uma nomenclatura própria. Por exemplo, EcoRI refere-se à primeira (I) enzima isolada do género Escherichia (E). espécie coli (co), estirpe RY13 (R) e Hind III à terceira enzima (III) isolada de Haemophilus influenzae, estirpe Rd.

[edit] Exercício 1 – Extremidades e ligações Considere as seguintes enzimas e respectivas sequências de restrição ( o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT

Que característica invulgar tem a sequência de reconhecimento destas enzimas? A caracteristica especial da enzima é a capacidade de reconhecer um palindroma na sequencia, ou seja, ambos as cadeias têm a mesma sequência de nucleotídeos mas em orientações inversas. exemplo: 5'-GAATTC-3'

        3'-CTTAAG-5'


Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas. Bam HI : 5'- G|GATCC -3'

        3'- CCTAG|G -5'

Hae II: 5'- GG|CC -5'

       3'- CC|GG -3'

Eco RI: 5'- G|AATTC -3'

       3'- CTTAA|G -5'

BglII: 5'- A|GATCT -3'

       3'- TCTAG|A -5'

É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por: BamHI? EcoRI? BglII? Com a BamHI e com a BglII sim, mas com a EcoRI. A enzima EcoRI reconhece um palindroma diferente do da enzima BamHI, ou seja, quando ocorre o corte desta sequencia são formadas extremidades coesivas diferentes das criadas com a enzima BamHI. Assim, ao se tentarem ligar sequencias cortadas por enzimas de restrição diferentes a ligação não ocorre. No entanto, quando cortada com a enzima BglII criam-se extremidades coesivas complementares das criadas com a Bam HI, o que permite que ocorra a ligaçao entre elas.

Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique. Os fragmentos resultantes da digestão de DNA geníomico humano com a Bam HI são maiores do que os fragmentos com a Hae II. Existe menor probabilidade de encontrar a sequencia de restrição da BamHI no genoma do que a sequencia de restrição da enzima Hae II. Como há menor probalidade os fragmentos são maiores, a enzima corta menos vezes no genoma, logo os fragmentos sao maiores.


[edit] Exercício 2 – Mapas de restrição As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose. Reveja os conceitos associados à electroforese em gel de agarose e veja um exemplo virtual da sua aplicação em http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html


A que correspondem as bandas azuis no gel?

No gel observa-se 2 tipos de bandas, as azul-claro e as azul-escuro. As bandas azuis claro correspondem a azul de xilene, enquanto que as azul escuro correpsondem a azul de bromofenol. Estes 2 tipos de bandas permitem ter uma noção da localização dos fragmentos de DNA, durante o processo de electroforese, sem ser necessário recorrer à utilização da luz UV. Assim, são evitados determinados erros, como por exemplo, que o gel corra demasiado tempo.


Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar? Porquê?

Espera-se obter 5 fragmentos utilizando a PleI e 4 fragmentos com a Bgl1, visto que existem 4 e 3, respectivamente, locais de restrição. No entanto, através da observação da imagem da electroforese após ligar a luz UV, no caso da PleI surgem 2 bandas, contudo possuem larguras diferentes. No caso da enzima Bg1I surgem 3 bandas de tamanhos idênticos. Estes erros devem-se provavelmente a um tempo insuficiente de electroforese ou a uma baixa concentração de agarose no gel.


Que papel tem a concentração de agarose na análise de fragmentos de restrição? Quanto maior a concentração de agarose, menor vai ser o tamanho dos poros do gel. Moléculas com menor tamanho vao correr no gel mais rapidamente distanciando-se mais do poço onde o DNA foi aplicado. Assim a resolução da electroforese é maior permitindo distiguir fragmentos de tamanhos semelhantes.


Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo?

Para determinar o tamanho dos fragmentos de DNA, deve-se adicionar uma coluna na electroforese que corresponde a um marcador molecular.

Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê?

Sim, porque na electroforese observamos 6 fragmentos que advem do corte da enzima EcoRI, no genoma do bacterófago lambda, nos seus 5 locais de restrição.

Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas: Quantas moléculas de DNA estão na primeira e na última banda observadas no gel? DNA lambda ---- 31.6x10^5 Da 1.66x10^-27g ---- 1 Da DNA lambda = 52,456 x 10^-22g 1ª banda DNA lambda ---- 52,456 x 10^-22g

Que quantidade de DNA está nas mesmas bandas?

Fragmentos: 1-21228 2-4878 3-5643 4-7421 5-5804 6-3530

Sabendo que foi utilizado um total de um micrograma de DNA no gel e que o genoma do bacteriofago lambda contem 48510 pares de bases, entao na 1a banda: 1micrograma --- 48510

    x      --- 21228    x=0,438 microgramas

na última banda: 1microgrma --- 48510

    x     --- 3530      x= 0,073 microgramas


Na 1 banda existe 0,438 microgramas de DNA, enquanto que na última banda existem 0,073 microgramas de DNA.

Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:

DNA x EcoRI = 5000 + 3000 + 2000 DNA x HindIII = 5500 + 4500 DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500 Com base nesta informação, construa o mapa de restrição desta molécula.

Mapa de restrição com EcoRI: 5’__________________________|____________|_______________3’ 5000pb 2000pb 3000pb Ou 5’__________________________|________________|___________3’ 5000pb 3000pb 2000pb


Mapa de restrição com HindIII: 5’__________________________|___________________________3’ 5500pb 4500pb Ou 5’__________________________|___________________________3’ 4500pb 5500pb

Assim o mapa de restriçao desta molecula, consoante o tamanho dos fragmentos que foram obtidos pela restrição das 2 enzimas (5000, 3000, 1500 e 500pb), e sobrepondo as diferentes possibilidades dos mapas de restrição das 2 enzimas, temos que a única possibilidade é de o mapa ser o seguinte:

5’__________________________|____|_______|________________3’ E H E

         5000pb	    500pb   1500pb	3000pb


Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:

uma enzima de corte único; BamHI - posição: 347 seq. de reconhecimento: g/gatcc EcoRI - posição: 414 seq. de reconhecimento: g/aattc

uma enzima com dois cortes; AlwI - posições: 195, 351 seq. de reconhecimento: ggatc PleI - posições: 66, 184 seq. de reconhecimento: gagtc

uma enzima que não corta neste DNA. BgIII - seq. de reconhecimento: A GATC T HindIII - seq.de reconhecimento: A AGCT T


(ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)



[edit] Exercício 3 – Enzimas de restrição, RFLPs (Restriction Fragment Length Polymorphisms) e diagnóstico de mutações As variações de sequência do genoma humano podem resultar na alterção de locais de corte de enzimas de restrição. As bandas polimórficas observadas após a electroforese de amostras de DNA genómico após tratamento com enzimas de restrição (RFLPs) constituíram o primeiro método laboratorial de “impressões digitais” de DNA para identificação de indivíduos em Medicina legal e forense.

Da mesma forma, mutações causadoras de doença podem gerar variações nos locais de corte de enzimas de restrição que permitem um fácil diagnóstico da sua presença.

O gene humano que codifica a beta-globina possui 3 locais de restrição DdeI. A distância entre o primeiro e o segundo local é de 175 bp. A distância entre o segundo e o terceiro local é de 201 bp. Em indivíduos com anemia de células falciformes ocorre uma mutação que anula o segundo local de restrição DdeI.

Represente esquematicamente o gene normal e o gene mutado, indicando as posições relativas dos 3 locais DdeI.

Gene normal: 5’_______________|___________|___________|________________3’

                       175pb 	201pb

Gene mutado: 5’_______________|_______________________|________________3’

                        376pb (175+201)

Proponha um procedimento para diagnóstico desta mutação com base na técnica de PCR. O PCR é uma técnica que permite a amplificação da região onde a mutação se localiza nos pacientes portadores da doença. Após a reacção de PCR, podemos utilizar o material amplificado para constatar a presença da mutação através da digestão com enzimas de restrição, hibridização com oligonucleotídeos ou sequenciamento. Neste caso apos a amplificaçao do fragmento utilizando primers que flaqueiam o local da mutação e faz-se a digestão com a enzima Ddel. Por fim, a visualização do resultado da digestão do DNA por esta enzima pode ser feito rercorrendo a técnica de electroforese. Caso haja mutação(individuo homozigótico) a enzima não reconhece o local de corte e por isso apenas se visualiza um fragmento; se não houver mutação(individuo homozigótico) a enzima corta e obtem-se 2 fragmentos. Existindo ainda a possibilidade de o individuo ser heterozigotico, obtêm-se 3 bandas, por existencia de um alelo mutado e de um alelo selvagem.

Represente esquematicamente os resultados que espera observar ao analisar um indivíduo saudável, um portador da mutação (heterozigótico) e um doente (homozigótico). Num individuo saudável em nenhum dos seus alelos se encontra a mutação. Assim ao amplificar o DNA do gene da beta globina por PCR, na região que flanqueia a mutação, e depois de o submeter à digestão pela enzima de restrição Ddel, vão surgir no gel de electroforese, 2 bandas, visto que esta enzima corta uma vez na zona amplificada pelos 2 primers. Num individuo heterozigotico (portador da doença), vão surgir 3 bandas no gel de electroforese. Sendo heterozigótico implica que a mutação vai surgir em um dos seus alelos. Surgem então 2 bandas que correspondem aos fragmentos que derivam do corte da enzima Ddel, e uma 3ªbanda vai corresponder a um fragmento de tamanho maior, que se forma devido à presença da mutação que altera o local de corte da enzima, fazendo com que não haja corte do DNA naquele local ( que corresponde à soma das 2 bandas obtidas a partir do alelo normal). Num individuo doente (homozigótico) surge na electroforese apenas 1 banda, pois sendo ele homozigótico implica que a mutação está presente em ambos os alelos, logo a enzima não reconhece o local de corte.

normal: 2 bandas heterozigozito: 3 bandas homoziotico doente: 1banda


Normal Heter. Homoz. (doente) _______ _______ _______ _______ _______ _______




Personal tools