User:Goncalo Correia/Notebook/BIOMOL/2010/04/27

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

TP 6

Digestão de DNA com enzimas de restrição

As enzimas de restrição são o bisturi dos biologistas moleculares pois permitem “cortar” o DNA de um modo preciso e reprodutível.

As enzimas de restrição fazem parte do grupo das nucleases, enzimas que clivam ligações fosfodiester entre nucleótidos adjacentes. As enzimas de restrição usadas em biologia molecular têm a grande vantagem de clivarem apenas as ligações entre nucleótidos com uma sequência específica. Existem comercializadas perto de 100 enzimas de restrição, cada uma das quais reconhece e cliva uma sequência única de nucleótidos.

As enzimas de restrição identificam-se por uma nomenclatura própria. Por exemplo, EcoRI refere-se à primeira (I) enzima isolada do género Escherichia (E). espécie coli (co), estirpe RY13 (R) e Hind III à terceira enzima (III) isolada de Haemophilus influenzae, estirpe Rd.

Exercício 1 – Extremidades e ligações

Considere as seguintes enzimas e respectivas sequências de restrição ( o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT

  1. Que característica invulgar tem a sequência de reconhecimento destas enzimas?

As sequências de reconhecimento são palindrómicas.

  1. Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas.

Bam HI:

G---GATCC 5'  
CCTAC---G 3'

Hae II:

GG---CC 5'
CC---GG 3'

Eco RI:

G---AATTC 5'
CTTAA---G 3'

Bg III:

A---GATCT 5'
TCTAG---A 3'
  1. É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por: BamHI? EcoRI? BglII?

É possível ligar uma molécula de DNA cortada por Bam HI a outra cortada por Bam HI e Bg III, mas não com Hae II ou Eco RI.

  1. Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique.

Os fragmentos resultantes de digestão de gDNA humano por Bam HI serão maiores que os fragmentos resultantes da digestão por Hae II, porque a sequência de reconhecimento da primeira tem um tamanho maior, logo a probabilidade de encontrar uma sequência destas no genoma é menor, o que leva a menos cortes e fragmentos com maior tamanho.

Exercício 2 – Mapas de restrição

As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose. Reveja os conceitos associados à electroforese em gel de agarose e veja um exemplo virtual da sua aplicação em http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html

  1. A que correspondem as bandas azuis no gel?

As bandas azul-claro são bandas de azul de xilene, e o azul escuro por azul de bromofenol. Servem de guia para o processo de electroforese, para ter uma ideia da localização dos fragmentos sem usar luz UV e evitar erros como deixar o gel a correr demasiado tempo.

  1. Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar? Porquê?

No caso do PleI esperava 4 fragmentos, observam-se 3, mas isto é devido a resolução, dois deles têm tamanhos praticamente idênticos. Seria preciso aumentar o tempo da electroforese ou a concentração de agarose no gel.

  1. Que papel tem a concentração de agarose na análise de fragmentos de restrição?

Quanto maior a concentração de agarose, menor o tamanho dos poros no gel, e maior será a resolução da electroforese, o que permite uma melhor distinção entre fragmentos de tamanhos similares.

  1. Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo?

Usando o marcador molecular é possível fazer uma recta de calibração, através de regressão log-linear. Usando essa recta é possível descobrir de forma precisa o tamanho do fragmento em função da distância percorrida no gel.

Image:BIOMOL_LCS_DadosTP6.jpg

Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

  1. Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê?

Sim, podemos ver na electroforese 6 fragmentos, resultantes do corte de uma molécula de DNA em 5 locais.

  1. Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas:
    1. Quantas moléculas de DNA estão na primeira e na última banda observadas no gel?

O número de moléculas de DNA presentes nas duas bandas é igual, 1,908*10^10 moléculas de DNA. Fragmentos... 1-> 21228 2->4878 3->5643 4->7421 5->5804 6-> 3530

    1. Que quantidade de DNA está nas mesmas bandas?

1ª Banda -> 440 ng 2ª Banda -> 73ng


Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:

  1. DNA x EcoRI = 5000 + 3000 + 2000
  2. DNA x HindIII = 5500 + 4500
  3. DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500
    1. Com base nesta informação, construa o mapa de restrição desta molécula.

Start - 5000 (EcoRI) 500 (HindIII) 1500 (EcoRI) 3000 END Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:

  1. uma enzima de corte único;

AccI

  1. uma enzima com dois cortes;

AleI

  1. uma enzima que não corta neste DNA.

AatII (ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)

Exercício 3 – Enzimas de restrição, RFLPs (Restriction Fragment Length Polymorphisms) e diagnóstico de mutações

As variações de sequência do genoma humano podem resultar na alterção de locais de corte de enzimas de restrição. As bandas polimórficas observadas após a electroforese de amostras de DNA genómico após tratamento com enzimas de restrição (RFLPs) constituíram o primeiro método laboratorial de “impressões digitais” de DNA para identificação de indivíduos em Medicina legal e forense.

Da mesma forma, mutações causadoras de doença podem gerar variações nos locais de corte de enzimas de restrição que permitem um fácil diagnóstico da sua presença.

O gene humano que codifica a beta-globina possui 3 locais de restrição DdeI. A distância entre o primeiro e o segundo local é de 175 bp. A distância entre o segundo e o terceiro local é de 201 bp. Em indivíduos com anemia de células falciformes ocorre uma mutação que anula o segundo local de restrição DdeI.

  1. Represente esquematicamente o gene normal e o gene mutado, indicando as posições relativas dos 3 locais DdeI.

Gene Normal: Local 1 --175bp -- Local 2 -- 201 bp -- Local 3 Gene Mutante: Local 1 ---------- 376 bp --------- Local 3

  1. Proponha um procedimento para diagnóstico desta mutação com base na técnica de PCR.

Extração de gDNA, amplificação por PCR (usando o protocolo da TP4 por ex.), fazer um tratamento com a enzima de restrição DdeI e em seguida correr num gel de electroforese e comparar os tamanhos com um controlo, com recurso a um marcador de peso molecular.

  1. Represente esquematicamente os resultados que espera observar ao analisar um indivíduo saudável, um portador da mutação (heterozigótico) e um doente (homozigótico).

Indíviduo Saudável - Duas bandas, uma de 175 bp e outra com 201 bp. Portador de mutação - Três bandas, 175 bp, 201 bp e 376 bp. Doente - Uma banda de 376 bp.



Personal tools