User:Howard Boland/Notebook/Art from Synthetic Biology/2010/10/14

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Primers arrive

Finally got the 4 primers for the long range PCR, one to take out my original design excluding the origin of replication and the second to take out an origin of replication with a high copy number.

I am not sure how this will work and I tried doing the design through Geneious that supposedly uses Primer3 as its search basis. Since my pfu Taq has not yet arrived all I can do is to prepare the primers into 100µmol by adding relevant liquid. The reconstitution for the primers into liquid form is done by first converting nmole primer stock solution into µmole and then divide the desired consentation (100µmole) in µmole/litre. E.g. 100µmole primer stocksolution assuming 24µmole yield 24nmole*1µmole/1000nmole = 0.024µmole => 0.024µmol/100µmole/litre = 0.00024 L => 0.00024 L *1000mL/L = 0.24ml = 240µl

pUA66katE Primers to extract katE sensor-part:

Fwd pUA66katE-LR-PstI, GCCTGCAGGCGGCAACCGAGCGTTCTGA: 36.5 nmoles => add 365 µl H2O for 100µmole concentration


Rev pUA66katE-LR-PstI, GCCTGCAGGCCCAGTCTTTCGACTGAGCCT: 33.1 nmoles => add 331 µl H2O for 100µmole concentration

pMAK512 Primers to extract pBR322

Fwd pMAK512-pBR322-PstI, GCCTGCAGCTGCGGCGAGCGGTATCAGC: 29.2 nmoles => add 292 µl H2O for 100 µmole concentration

Rev pMAK512-pBR322-PstI, GCCTGCAGTCCCTTAACGTGAGTTTTCGTTCCAC: 33.0 nmoles => add 330 µl H2O for 100µmole concentration



Personal tools