User:Howard Boland/Notebook/Art from Synthetic Biology/2010/10/18

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

pfu Taq Polymerase arrives

My long-range pfu Taq polymerase arrived from stratagen! Finally we can setup the PCRs. Interestingly it arrived in a massive box of dry ice and was then placed directly in -80ºC. I wish Halloween was a bit closer so the dry ice could come to some use...

I set up to PCR reactions with the new primer set and using my plasmids as templates.

pMAK512, pBR322 extract

To check conditions I prepared two tubes (not master mix)

PCR mix

  1. 40.1µl H20
  2. 4µl 10xpfu Polymerase Buffer
  3. 0.4 10mM dNTP (not supplied with kit)
  4. 1µl pMAK512 plasmid template (100ng/µl)
  5. 1.25µl Primer forward
  6. 1.25µl Primer reverse
  7. 1µl pfu Polymerase

PCR conditions Cycles: 32x Lid: 100ºC Volume: 50µl (each)

  1. Initial: 94ºC, 10 min
  2. Denature: 94ºC, 1 min
  3. Annealing: 63ºC, 50sec
  4. Extension: 70ºC, 1min 12sec
  5. Goto 2, 32 times
  6. Final: 70ºC, 10 min
  7. Rest: 8ºC, forever

Expected product size: 790b

Calculation of Extension time: 0.79kb*1.5min/kb = 1min 12 sec

Calculation of Annealing temperature:

CTGCGGCGAGCGGTATCAGC => G/C = 14, A/T = 6 => 14*4ºC + 6*2ºC = 68ºC => Lower by 5ºC => 63ºC TCCCTTAACGTGAGTTTTCGTTCCAC => G/C = 12, A/T = 14 => 12*4ºC + 14*2ºC = 72ºC => Lower by 5ºC => 67ºC

Select minimum of the two gives us the annealing temerature of 63ºC

pUA66katE, sensor part extract

To check conditions I prepared two tubes (not master mix)

PCR mix

  1. 40.1µl H20
  2. 4µl 10xpfu Polymerase Buffer
  3. 0.4 10mM dNTP (not supplied with kit)
  4. 1µl pUA66katE plasmid template (20ng/µl)
  5. 1.25µl Primer forward
  6. 1.25µl Primer reverse
  7. 1µl pfu Polymerase

PCR conditions Cycles: 32x Lid: 100ºC Volume: 50µl (each)

  1. Initial: 94ºC, 10 min
  2. Denature: 94ºC, 1 min
  3. Annealing: 61ºC, 50sec
  4. Extension: 70ºC, 2min 7sec
  5. Goto 2, 32 times
  6. Final: 70ºC, 10 min
  7. Rest: 8ºC, forever

Expected product size: 2359b

Calculation of Extension time: 02.359kb*1.5min/kb = 2min 7sec

Calculation of Annealing temperature:

GCGGCAACCGAGCGTTCTGA => G/C = 13, A/T = 7 => 13*4ºC + 7*2ºC = 66ºC => Lower by 5ºC => 61ºC GCCCAGTCTTTCGACTGAGCCT => G/C = 13, A/T = 9 => 13*4ºC + 9*2ºC = 70ºC => Lower by 5ºC => 65ºC

Select minimum of the two gives us the annealing temerature of 58ºC



Personal tools