User:Jessica Karen Wong/Primers

From OpenWetWare

Jump to: navigation, search

Contents

Scarring Primers

These will be used to PCR out T9002 in order to scar out the BB sites from a backbone plasmid.

  • T9002_F -- CTTAGTAG CAATTG TCCCTATCAGTGATAGAGATTGACATC
  • T9002_R -- TCAGCCAT ATGCAT TATAAACGCAGAAAGGCCCAC

Bold is the tail, italics is the restriction site.


  • New T9002 Reverse that matches only GFP TCAGCCAT ATGCAT TTATTATTTGTATAGTTCATCCATGCC
    • Melting Temp 55.0
  • Original T9002_F CTTAGTAG CAATTG TCCCTATCAGTGATAGAGATTGACATC has melting temp 53.9

Bold is the tail, italics is the restriction site.

  • New Longer I2055
    • Fwd- CTTAGTAG CAATTG TCCCTATCAGTGATAGAGATTGACATCCCTATC melting temp 62
    • Rev- TCAGCGAT ATGCAT TATAAACGCAGAAAGGCCCACCCG melting temp 63.6
  • New Shorter I2055
    • Fwd- CTTAGTAG CAATTG TCCCTATCAGTGATAGAGATTG melt 45.4
    • Rev- TCAGCGAT ATGCAT TATAAACGCAGAAAGGCC melt 45.5

Keep same tails?

  • Original I2055
    • Fwd- CTTAGTAG CAATTG tccctatcagtgatagagattgacatc melt 53.9
    • Rev- TCAGCGAT ATGCAT TATAAACGCAGAAAGGCCCAC melt 53.6 (is actually same primer as E0240R)
    • I2056:
      • F: Same as I2055
      • R: same as I2055
    • I2057:
      • F: CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGGC (52.1)
      • R: same as I2055


Also designed primers to PCR R0040 in if none of the colonies were successfully ligated

   * Only ordered a forward primer with Tail including Mfe1 and R0040
   * format: 8-mer.MfeI.promoter+mix.part of gfp (Tm)
   * CTTAGTAG.CAATTG.tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactag.ATGCGTAAAGGAGAAGAACTTTTC (52.4)

Ordered new I2056 primers to PCR in Promoter

  • I2056_R0040_F 8mer.Mfe1.promoter+mix.part of RFP
  • CTTAGTAG CAATTG tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactag ATGGCTTCCTCCGAAGACG (54.0)

BioBrick Primers

   * E0240:
         o F (incl E0240, PstI): CTTAGTAG.ACTAGT.TCACACAGGAAAGTACTAGATGCG (53.1)
         o R (incl 3K3/1AK3, EcoRI): TCAGCGAT.GAATTC.CAGAAATCATCCTTAGCGAAAGC (54.2) 
   * I2057:
         o F (incl I2057, PstI): CTTAGTAG.ACTAGT.TCACACAGGAAAGTACTAGATGGC (52.1)
         o R: same as E0240 
   * I2055:
         o F (incl GFP, SpeI): CTTAGTAG.ACTAGT.ATGCGTAAAGGAGAAGAACTTTTC (52.4)
         o R (incl R0040, EcoRI): TCAGCGAT.GAATTC.GTGCTCAGTATCTCTATCACTGATAGG (52.0) 
   * I2056:
         o F (incl RFP, SpeI): CTTAGTAG.ACTAGT.ATGGCTTCCTCCGAAGACG (54.0)
         o R: Same as I2055 
   * For T9002:
         o F (incl RBS, GFP,EcoRI): TCAGCGAT.CTGCAG.TCACACAGGAAAGTACTAGATGCG (53.1)
         o R (incl lux pR, PstI) : CTTAGTAG.GAATTC.TTTATTCGACTATAACAAACCATTTTC (51.9)

Format: 8-mer.restriction site.primer

New Primers

T9002 pieces

  • F2620-F 8mer mfe1 TCCCTATCAGTGATAGAGATTGACATC 53.9
  • CTTAGTAG CAATTG TCCCTATCAGTGATAGAGATTGACATC
  • F2620-R 8mer xba1 not1 eco1 TTTATTCGACTATAACAAACCATTTTC 51.9
  • TCAGCGAT CTCTAGAAGCGGCCGCGAATTC TTTATTCGACTATAACAAACCATTTTC


  • E0240-F 8mer spe1 NOT1 pst1 TCACACAGGAAAGTACTAGATGCG 53.1
  • CTTAGTAG tactagtagcggccgctgcag TCACACAGGAAAGTACTAGATGCG
  • E0240-R 8mer nsi1 GTGGGCCTTTCTGCGTTTATA 53.6
  • TCAGCGAT ATGCAT GTGGGCCTTTCTGCGTTTATA

I2055/I2056 to account for RBS spacing

  • I2055-F 8mer Xba1 ATGCGTAAAGGAGAAGAACTTTTC 52.4
  • CTTAGTAG TCTAGA TGCGTAAAGGAGAAGAACTTTTC
  • I2055-R 8mer xba1 NOT1 ecor1 GTGCTCAGTATCTCTATCACTGATAGG 52.0
  • TCAGCGAT CTCTAGAAGCGGCCGCGAATTC GTGCTCAGTATCTCTATCACTGATAGG
  • I2056-F 8mer Xba1 ATGGCTTCCTCCGAAGACG 54.0
  • CTTAGTAG TCTAGA TGGCTTCCTCCGAAGACG
  • I2056-R same as I2055-R

Nishant's Primers

1) TCAGCGAT GCGGCCGC GAATTC CAGAAATCATCCTTAGCGAAAGC, BB_P_Rev_Eco

2) CTTAGTAG GCGGCCGC ACTAGT TCACACAGGAAAGTACTAGATGCG, BB_E0240_Fwd_Spe

3) CTTAGTAG GCGGCCGC TCTAGA TCACACAGGAAAGTACTAGATGCG, BB_E0240_Fwd_Xba

4) TCAGCGAT GCGGCCGC ACTAGT GTGCTCAGTATCTCTATCACTGATAGG, BB_R_Rev_Spe

5) TCAGCGAT GCGGCCGC GAATTC GTGCTCAGTATCTCTATCACTGATAGG, BB_R_Rev_Eco

6) CTTAGTAG GCGGCCGC TCTAGA ATGCGTAAAGGAGAAGAACTTTTC, BB_I2055_Fwd_Xba

7) TCAGCGAT GCGGCCGC GAATTC TTTATTCGACTATAACAAACCATTTTC, BB_T9002_Rev_Eco

8) CTTAGTAG GCGGCCGC GAATTC TCACACAGGAAAGTACTAGATGCG, BB_T9002_Fwd_Pst

9) CTTAGTAG GCGGCCGC TCTAGA ATGGCTTCCTCCGAAGACG, BB_I2056_Fwd_Xba

10) CTTAGTAG GCGGCCGC ACTAGT TCACACAGGAAAGTACTAGATGGC, BB_I2057_Fwd_Spe

11) CTTAGTAG GCGGCCGC TCTAGA TCACACAGGAAAGTACTAGATGGC, BB_I2057_Fwd_Xba


REVISION 7-23


  • CTTAGTAG GCGGCCGC ACTAGT G TCACACAGGAAAGTACTAGATGCG, BBbp_E0240_Fwd_Spe
  • CTTAGTAG GCGGCCGC TCTAGA G TCACACAGGAAAGTACTAGATGCG, BBbp_E0240_Fwd_Xba
  • CTTAGTAG GCGGCCGC ACTAGT G TCACACAGGAAAGTACTAGATGGC, BBbp_I2057_Fwd_Spe
  • CTTAGTAG GCGGCCGC TCTAGA G TCACACAGGAAAGTACTAGATGGC, BBbp_I2057_Fwd_Xba
  • TCAGCGAT GCGGCCGC ACTAGT A GTGCTCAGTATCTCTATCACTGATAGG, BBbp_R_Rev_Spe
  • CTTAGTAG GCGGCCGC TCTAG ATGCGTAAAGGAGAAGAACTTTTC, BBbp_I2055_Fwd_Xba
  • CTTAGTAG GCGGCCGC TCTAG ATGGCTTCCTCCGAAGACG, BBbp_I2056_Fwd_Xba
Personal tools