User:Karmella Haynes/Notebook/BioBrick cloning/2010/06/05

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

06/05/10

  • ✓ Order primers: for Hygro amplification

Order Primers

> PCR insert: Hygromycin R gene from V0200 (new oligos with longer ends):

  1. Hygro f2 5'-tagcagacatagacaga gatgaggatc atg AAAAAGCCTGAACTCACCGC (has BsaBI and Met)
  2. Hygro r2 5'-cagccgaatcgcatcgacgcgtac ttcgaa CTATTCCTTTGCCCTCGGAC (has BstBI)



Personal tools