User:Lindenb/Notebook/UMR915/20101104
From OpenWetWare
< User:Lindenb | Notebook | UMR915
Contents |
SOAPAligner
testing soap aligner:
soap2.20release/soap -a xx_3_1.fastq.gz -bxx_3_2.fastq.gz -D hg18.fa.index -o ~/soap_results.data -2 ~/unpaired.data File Error: unrecognized file
hum... it doesn't like the gzipped fastq ?... :-/ unzippinf...
/usr/local/package/soap2.20release/soap -a XX_3_1.fastq -b XX_3_2.fastq -D hg18.fa.index -o soap_results.data -2 unpaired.data -m 200 -x 600
Begin Program SOAPaligner/soap2
Thu Nov 4 11:18:24 2010
Reference: hg18.fa.index
Query File a: 4366_3_1.fastq
Query File b: 4366_3_2.fastq
Output File: soap_results.data
unpaired.data
Load Index Table ...
Load Index Table OK
Begin Alignment ...
131072 ok 86.16 sec
262144 ok 84.23 sec
393216 ok 93.31 sec
524288 ok 90.48 sec
(...)
70254592 ok 62.22 sec
70385664 ok 58.87 sec
70516736 ok 59.30 sec
70647808 ok 58.74 sec
70778880 ok 59.80 sec
70909952 ok 55.67 sec
71041024 ok 55.21 sec
71172096 ok 52.78 sec
71303168 ok 54.85 sec
71434240 ok 59.92 sec
71473618 ok 17.14 sec
Total Pairs: 35736809 PE
Paired: 14641084 (40.97%) PE
Singled: 34692762 (48.54%) SE
Total Elapsed Time: 33175.70
- Load Index Table: 14.96
- Alignment: 33160.74
SOAPaligner/soap2 End
Thu Nov 4 21:57:26 2010
Results
[lindenb@srv-clc-02 lindenb]$ ls -lah soap_results.data unpaired.data -rw-r--r-- 1 lindenb users 4.8G Nov 4 21:57 soap_results.data -rw-r--r-- 1 lindenb users 5.7G Nov 4 21:57 unpaired.data
file soap_results.data unpaired.data soap_results.data: ASCII text unpaired.data: ASCII text
[lindenb@srv-clc-02 lindenb]$ more soap_results.data IL36_4366:3:1:1056:15626/1 CCAAGGGAGCTTATTAGTCCCTTCCACCATGTGAGGACGCAAGAAGGCATCATC 9305(3-=<8)<?/9:+48?;(5:6=@C:;4<==-?;C9<?8<ABA3CBA?A5E 1 a 54 - chr7 36927164054M 54 IL36_4366:3:1:1056:15626/2 GAAATGCCGTCTTGCTTGAAAAGTCCTTCTTAACTCTCCCACAAGTCACTCTCT E-E4EEAE?59>=C9A7?A:=E?@A:;)4:<8488=;B<=6*.2;*8<+4)=98 1 b 54 + chr7 36926895054M 54 IL36_4366:3:1:1059:7264/1 TCTTTCTTCAGCTTCTTGGGCGAAACAGGGAGTCTTTCCTGTGGACTCAGCTTG 8437CE=AA=+C<?>:36.11@@@.CFBFA9<B>@==@>C;55;A<-1>;F;-? 2 a 54 - chr17 40983027054M 54 IL36_4366:3:1:1059:7264/2 TCTTCAAGGGTCTCTGGATTTTGAGTTTCGGGCTCTAGATGGAATTGAGAAGGT D>DD7DB8BAA-BD?@=94B4AAAA3>@AD<;6-6=DDA8*=7>4)<=<<9<3= 2 b 54 + chr17 40982790054M 54
[lindenb@srv-clc-02 lindenb]$ more unpaired.data IL36_4366:3:1:1053:17041/1 AGACAGCAGTTAGTTGGTTGGTGAGTTCTTATCCATTCTGCTGTTCTGTATCTT =<@=;@B>;30</C99*>0@=D4E7>:>8@+1@8BDD:ABAC@<CDABDBE8DB 4 a 54 - chr4 92885278 2 A->41T3 G->9T-13 54M 9G31A12 IL36_4366:3:1:1053:7122/1 GGCAGTGCCTCTACCCTCCTCCTTAAGTTTCTATGGTCCCTGCTGCTCCTGGCC 5)8(6+8?@>@--9?;,4>3=E?A@@8@6;?;+?B*?;?@;5A@'>2>:>40>A 1 a 54 - chr6 31233127 0 54M 54 IL36_4366:3:1:1053:7122/2 GAAAGAGACAGACTGAGAGGGGCTCTGAGGCTTTACTCATACTTTCAGGATTCT $6&')$'&4926<-..6%,%-)%68/8=84+-4<(-*/*.6(52*2.D/&-5/% 1 b 54 + chr6 31233072 0 54M 54
Galaxy
wget "http://bitbucket.org/galaxy/galaxy-dist/get/tip.zip" unzip tip.zip cd galaxy-dist sh setup.sh Copying datatypes_conf.xml.sample to datatypes_conf.xml Copying reports_wsgi.ini.sample to reports_wsgi.ini Copying tool_conf.xml.sample to tool_conf.xml Copying tool_data_table_conf.xml.sample to tool_data_table_conf.xml Copying universe_wsgi.ini.sample to universe_wsgi.ini Copying tool-data/alignseq.loc.sample to tool-data/alignseq.loc Copying tool-data/annotation_profiler_options.xml.sample to tool-data/annotation_profiler_options.xml Copying tool-data/annotation_profiler_valid_builds.txt.sample to tool-data/annotation_profiler_valid_builds.txt Copying tool-data/bfast_indexes.loc.sample to tool-data/bfast_indexes.loc Copying tool-data/binned_scores.loc.sample to tool-data/binned_scores.loc Copying tool-data/blastdb.loc.sample to tool-data/blastdb.loc Copying tool-data/bowtie_indices.loc.sample to tool-data/bowtie_indices.loc Copying tool-data/bowtie_indices_color.loc.sample to tool-data/bowtie_indices_color.loc Copying tool-data/encode_datasets.loc.sample to tool-data/encode_datasets.loc Copying tool-data/liftOver.loc.sample to tool-data/liftOver.loc Copying tool-data/maf_index.loc.sample to tool-data/maf_index.loc Copying tool-data/maf_pairwise.loc.sample to tool-data/maf_pairwise.loc Copying tool-data/microbial_data.loc.sample to tool-data/microbial_data.loc Copying tool-data/phastOdds.loc.sample to tool-data/phastOdds.loc Copying tool-data/quality_scores.loc.sample to tool-data/quality_scores.loc Copying tool-data/regions.loc.sample to tool-data/regions.loc Copying tool-data/sam_fa_indices.loc.sample to tool-data/sam_fa_indices.loc Copying tool-data/srma_index.loc.sample to tool-data/srma_index.loc Copying tool-data/twobit.loc.sample to tool-data/twobit.loc Copying tool-data/shared/ucsc/builds.txt.sample to tool-data/shared/ucsc/builds.txt Creating database/files Creating database/community_files Creating database/tmp Creating database/compiled_templates Creating database/job_working_directory Creating database/import Creating database/pbs Creating static/genetrack/plots Creating tool-data/shared/jars One or more of the python eggs necessary to run Galaxy couldn't be downloaded automatically. You can try building them by hand (all at once) with: python scripts/scramble.py Or individually: python scripts/scramble.py Mako python scripts/scramble.py Babel python scripts/scramble.py Whoosh python scripts/scramble.py Tempita python scripts/scramble.py Cheetah python scripts/scramble.py lrucache python scripts/scramble.py sqlalchemy_migrate python scripts/scramble.py NoseHTML python scripts/scramble.py pexpect python scripts/scramble.py bx_python python scripts/scramble.py PasteDeploy python scripts/scramble.py WebHelpers python scripts/scramble.py docutils python scripts/scramble.py numpy python scripts/scramble.py pysqlite python scripts/scramble.py Beaker python scripts/scramble.py SVGFig python scripts/scramble.py SQLAlchemy python scripts/scramble.py simplejson python scripts/scramble.py WebError python scripts/scramble.py python_lzo python scripts/scramble.py wchartype python scripts/scramble.py twill python scripts/scramble.py Routes python scripts/scramble.py elementtree python scripts/scramble.py decorator python scripts/scramble.py pycrypto python scripts/scramble.py Paste python scripts/scramble.py wsgiref python scripts/scramble.py nose python scripts/scramble.py amqplib python scripts/scramble.py WebOb python scripts/scramble.py PasteScripttomcat already running on port 8080: edit universe_wsgi.ini and change
port=8020
but problem with the proxy
GEM
> gem-mapper
Welcome to GEM-mapper build 544 (beta) - (2009/10/07 02:50:12 GMT)
(c) 2008-2010 Paolo Ribeca <paolo.ribeca@gmail.com>
************************************************************************
* WARNING: this is a beta version, provided for testing purposes only; *
* check for updates at <http://www.paoloribeca.net/software/GEM>. *
************************************************************************
Names of index, input and output file are mandatory
Usage:
gem-mapper
-I <index_prefix> (mandatory)
-c|--colorspace (index is colorspace-encoded)
-e|--emulate-complement (for indices lacking it)
-i <input_file> (mandatory, FASTA or FASTQ)
-q|--quality-format 'ignore'|'phred'|'solexa'
(mandatory with FASTQ input)
--reads-per-block <number> (default=10000)
-o <output_prefix> (mandatory)
-t <thread_number> (default=1)
-m <max_mismatch_number> (default=2)
--mismatch-alphabet <symbols> (default="ACGT")
-Q|--quality-model 'gem'|'flat' (default='gem')
--gem-quality-threshold <number>
(default=26, that is e<=2e-3)
-d|--decoding-threshold 'all'|<number>
(default=10)
--filtering-threshold <number> (default=40)
--max-indel-length <number> (default=5)
--disable-accelerators (for debugging purposes)
-h|--help (print usage)
no paired-end sequencing ?
gem-mapper -i XXXX_1.fastq -o gemout -I gemhg18 -q phred
Welcome to GEM-mapper build 544 (beta) - (2009/10/07 02:50:12 GMT)
(c) 2008-2010 Paolo Ribeca <paolo.ribeca@gmail.com>
************************************************************************
* WARNING: this is a beta version, provided for testing purposes only; *
* check for updates at <http://www.paoloribeca.net/software/GEM>. *
************************************************************************
Thu Nov 4 12:46:54 2010 -- Loading index (likely to take long)... done.
Thu Nov 4 12:46:58 2010 -- Loading locations... done.
Thu Nov 4 12:46:58 2010 -- Pre-scanning input file... done
-- (FASTQ, it contains 35736809 reads).
Thu Nov 4 12:48:47 2010 -- #0 sequences processed
Thu Nov 4 12:48:52 2010 -- #10000 sequences processed
Thu Nov 4 12:48:57 2010 -- #20000 sequences processed
(...)
Thu Nov 4 17:37:57 2010 -- #35690000 sequences processed
Thu Nov 4 17:38:02 2010 -- #35700000 sequences processed
Thu Nov 4 17:38:06 2010 -- #35710000 sequences processed
Thu Nov 4 17:38:11 2010 -- #35720000 sequences processed
Thu Nov 4 17:38:15 2010 -- #35730000 sequences processed
Thu Nov 4 17:38:18 2010 -- #35736809 sequences processed
results
ls -lah gemout.0.map -rw-r--r-- 1 lindenb users 6.0G Nov 4 17:38 gemout.0.map IL36_4366:3:1:1053:17041/1 AAGATACAGAACAGCAGAATGGATAAGAACTCACCAACCAACTAACTGCTGTCT BD8EBDBADC<@CABA:DDB8@1+@8>:>7E4D=@0>*99C/<03;>B@;=@<= 0:1:3 chr1:F180110233T45@18/1,chr1 3:F36979712C13C52@65/2,chr6:R120088529T13T45@52/2,chr4:R92885278T13C45@52/2 IL36_4366:3:1:1053:7122/1 GGCCAGGAGCAGCAGGGACCATAGAAACTTAAGGAGGAGGGTAGAGGCACTGCC A>04>:>2>'@A5;@?;?*B?+;?;6@8@@A?E=3>4,;?9--@>@?8+6(8)5 1:0:0 chr6:R31233127@0/0 IL36_4366:3:1:1056:15626/1 GATGATGCCTTCTTGCGTCCTCACATGGTGGAAGGGACTAATAAGCTCCCTTGG E5A?ABC3ABA<8?<9C;?-==<4;:C@=6:5(;?84+:9/?<)8<=-3(5039 1:0:0 chr7:R36927164@0/0 IL36_4366:3:1:1056:1782/1 AAGATTCCAAATGGAAAAATAAAACTTTTGCCTTCTACTTGTTATTTTAGCACT :8A*@>$6<<AB>B?;?(;BB94,5BB;B<*2),)<6+@3>(88/-@@?8;97% 0:0:1 chr18:R3177698C4C54@13/2


