User:Margarida Azevedo/Notebook/Margarida Azevedo/2010/03/09

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Exercício TP2

  • Gene e mRNA

A sequência do genoma humano apresentada abaixo provém do cromossoma 11 e contém o gene da beta-globina:


CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG


A seguinte sequência corresponde ao mRNA da beta-globina:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA


   * Compare as duas sequências (utilize o alinhamento blast online) 
   * Que diferenças encontra e qual a sua origem? 
Foram transcritas 3 regiões. Há espaços que não foram transcritos, porque correspondem a intrões (parte da sequência removida no processo de splicing de pre-mRNAs, através da acção de spliceossomas e snRNAs, que vão reconhecer zonas de splicing, ou seja, zonas com intrões que devem ser removidas e zonas com exões que são mantidas). Posteriormente, ocorre um processo denominado splicing alternativo, que une os exões em várias combinações. A outra diferença corresponde a uma zona do mRNA (cauda de "AAAA")que não está contida no genoma, que resulta da adição de nucleótidos para a própria estabilização do mRNA. 
   * Onde se inicia a transcrição e porquê? 

A transcrição inicia-se no nucleótido 546 do DNA. Na sequência do genoma da beta globina que nos foi dado, podemos encontrar antes desta zona de iniciação a sequência ATAAA.Esta sequência corresponderá a parte do promotor,TATA box TATAAA (26 a 31 nucleotidos), que, apesar de incompleto, é suficiente para se dar a a transcrição no nosso sistema biológico.

   * Experimente traduzir ambas as sequências (tradução online). O que sucede e que implicações tem para o processo de expressão génica? 

Há zonas na cadeia de mRNA que correspondem a UTRs (untranslated regions)que regulam transcrição.

   * Se estivesse a comparar a sequência de um gene de E. coli e seu transcrito, que diferenças esperaria encontrar? E se fosse de S. cerevisiae (levedura)? 

Nos procariotas, como E.coli, 90% do DNA é codificante e não existe splicing alternativo. Além disso, genes policistrónicos (proteínas traduzidas em sucessão). As leveduras não têm intrões. Entre genoma e transcrito, as diferenças são mínimas.

   * As bactérias e leveduras podem ser crescidas facilmente em grandes quantidades, o que permite a utilização destes organismos como "fábricas" de produção de proteínas. Se pretender utilizar estes organismos para produzir uma proteína humana, que aspectos terá de ter em consideração? 

Usando DNA complementar, obtido através de mRNA (através da acção da transcriptase reversa). Através de mecanismos genéticos, obtém-se proteína.

[edit] Sequenciação de DNA [edit] Introdução

Estas sequências foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing


[edit] Questões

   * Considere o seguinte resultado de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem? 
   * O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo? 


   * Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo? 


   * Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder? 


   * Se a sequênciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações? 


   * Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano?



Personal tools