User:Margarida Gama-Carvalho/Notebook/Undergrad teaching/2010/03/02

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Exercício TP1

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

  • Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos?
  1. DNA
    1. A convenção implica que a sequência apresentada corresponde a uma das duas cadeias da dupla hélice, representada na orientação 5'-3'
    2. Quando se indica a sequência de um gene, regra geral é apresentada a sequência codificante
  2. RNA (sequências de transcritos)
    1. É apresentada a sequência na orientação 5'-3'
    2. Como apenas é possível a sequenciação de DNA, o que implica a trasncrição reversa das moléculas de RNA, os uracilos da molécula de RNA aparecem como timinas


  • Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real.

5'-TTGACACTACCGAGGTG-3'

3'-AACTGTGATGGCTCCTC-5'


  • Poderá esta sequência conter um gene? Justifique a sua resposta.

Pode. Um gene dá origem a um transcrito funcional, que pode ou não ser codificante (de proteína).

Não é fácil identificar genes com base apenas numa sequência e, concretamente, distingui-los de sequÊncias não codificantes, apesar de haver algumas marcas de referência. Por exemplo, caso a seja encontrado um quadro de leitura aberto na sequência apresentada, ela com grande probabilidade corresponderá a um fragmento de um gene.

A melhor maneira de detectar a presença de um gene numa sequência genómica é comparar com as sequências de transcritos, que hoje em dia vão sendo produzidas a grande ritmo por sequenciação automática.


  • Indique o resultado da transcrição desta sequência.

Há duas possibilidades dependendo de qual das cadeias do DNA é transcrita:

  1. UUGACACUACCGAGGUGUACT...
  1. CCAGGCUUCGUAUCCCGCUUU...


  • É possível prever que proteína se encontra codificada numa sequência nucleotídica?

Como?

Podemos prever a sequência de proteínas codificadas numa sequência de DNA aplicando o código genético e fazendo uma tradução teórica ou "in silico".

No entanto, nada garante a existência real dessa proteína.


  • A sequência apresentada codifica alguma proteína?

Sim. a tradução da sequência nas várias possibilidades teóricas identifica a existência de um quadro de leitura aberto de dimensões consideráveis.


  • Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana?

Com o código genético "bacteriano" existem outros codões iniciadores além do ATG típico dos eucariotas. Neste caso específico, o quadro de leitura aberto anteriormente identificado passa a ter uma metionina de iniciação logo no início.


  • Como poderia saber de que organismo provém esta sequência?

Comparando esta sequência com sequências genómicas conhecidas, por exemplo usando o algoritmo BLAST.



Personal tools